ExifMM*bj(1r2i-'-'Adobe Photoshop CC (Macintosh)2018:03:21 10:43:59  "*(2HH Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJ^iǯ`ɗm1Tk}nw^.Xlhډq!V{wK\t '#[X_YYg6' L3o hT/@#nfO_x6;,>ٟYvNExkM-v=۩OoXer3zּYkz؆ϭ?XKIi#C$jf˺eC%s0>|,O<P_C~vY^ߥ[]W{#\#֟|~Ҹ|,a/#h:rrX!wz/am}i?J~eq#PaI*>e:/[]w>{;J]\Y6k~aGVzWg׺o3Wi583i 45~=]ޕI$)$IJI$STI%)$IJ^ycA UfO~^ј%ib Md=eVbK H1kM`:{ݟA ۵>ۖ~?FFcQXhÑZGze6*k̢VEvAoN:ǐ^N[FjRΧcmy/uٶtoeoꪯ_Sqʰ^N.y}cf_.Ϸd;tזS1ƦʷYF9lF@ W{nߦ;j<lkwӧ1icSFvB{Sǻ}ڶٝq-v]Z/ǰmwOJg7?n6{q%yM}+.eQ94 +f5#)G8ϋ/qhxGOW6ygJwYT{kSc_Z3ّP᳻NgJ/FfGN7Uc8Ӑӣ[SË>Wk25*93ad?WadmY45)B Lїzӏwoz_<}qk ~%[aԖn?)=zRRu$I)I$JTI%)$IJ^O?F`>/#agּ ~S{;_l a{ڃYnoE3:کη .^]i\ʽ%<~E ٬ZwEs[ײi;np&4*:RӺgMeYF3f^㯵]k"uy[g)8]3s\=A?bOy.>[gt.i~UT}֯&ՕVwPȡpC[y5nNmnv3eCMG]z_Amy:_{wE,l}+[GΙfnQѵ) oή'ON}>݄r5+_Z1Ƨϱ`m±IFu44C0i2 Q=?!uzMʿe2]Tm@ ԲA=ޯ~g\L@ՇK2E_I875=bf<~M^I$*I$BI$TI%)$IJ^?cVn8÷[,g^,2+;,wING^ûXte׏iƓZֵ۽ܵ/=>+ cnf vU;}ig,g:.t2m[lwыGJW@9yUٌ1jV=tց ota) :\]CtXV?DzK`qޥ̭yGgMl}닲{l Wz~cxwjqvY/zߣgśy?Y- vљE6֖58?k74*=6m "L}?8˻m>j1Epgb;flz5!˲f.,cVma.uVQkv~znTkfCxuL 6lgfUZf0mv;O_`} n̼L7pq1#mROzﭘG7H&K>edX( 5ZG[g\z*tI%)$IOTI%)$IJ\:EFdHBW#:w2XX>o)̎g93׭A*]wnI[Z1iy=1X[c=lkNGVOȮ2rj;>ΡY6/UvVUv&;Uu^?FzXT܆32z,aVg5̳*=ȲDMb +m=S~çN}-vqq n^o1gCjFZzVFN_Q]՛ٴ˳j} Y]Tցnl= Wߓ_^90Z- o " :t.(MG7 fw׼::mE]$Ƽ>v_ң>~F_ز\:ia}uNvSyމ_{*^Syb>كK>ܕo*rpݑF~c]6Wn+j~5}+(OUfF6n9>e/2LħmT-M6]E~֦ASMϱc70M3n^k[\ȯ,g0:FvVRZK+}7U-vF3~N!}'-?kN I$RI$TI%)$IJ^gY_SK"c}{}r\'qmgJ_ce}&Mmk'?3{ҭӺKn b[YOk(׹owUYoz ےWơK孼잭f5 3z~f;^KGNU,cĺTfzi:Ks.4*~ik^U{3+Ư6G ,6tϬَQ}K0ՎCmfm5dg?e~~WZ8L7U:Wϳ=WUVBg'OÿiƤ'V.emn=m,,ic؎y=9$xxxէ :̜,\U*l}Np^˭/) ֬V`bM{|YNƲ:,L21qMcmeXƶ[\;o%u )bDӌ2lxSU?FQqіi,F@ACysybՋu5-s]7dX/UmͪG`#NP}\"-{1ZKw>2nUיqd )eJŃ=g5{i{9lk)2Y_"n;QXi` M;K>?wZF${g}RI$I$TI%)$IJ^im;e\ȟc{k~Y)9~0>Z$Wj7>zm}Tm,`k֗ov5_fo+:~ӱϑn]꺫Su!>N˸dl[oѲ~֫u,sk jJ߹Ov'>t[ Ie.[o7{Ee_|ztccҏs1=NNq̌IlmDXleUVQk0{-iIOk)uz{qƻ".c> U]_{w' 5??*6etlM ʲkINkF.7纜]eZ9o֌+ɭ}D>kZG%sC\n10Vgqk,-Ĵ;iɄ܏M]Gn]qA`[1qM-p o`uY/e7Pۃ mN_-R}vfmYWz~,]˧2 Q)xy-/;zS#Qڡ`j~n瑣;P^g)Yi}\z7KFG ^I$JRI$Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$Photoshop 3.08BIM8BIM%\/{gdպ8BIM: printOutputPstSboolInteenumInteClrmprintSixteenBitbool printerNameTEXTVersant-180_PRINTprintProofSetupObjcInstellen proef proofSetupBltnenum builtinProof proofCMYK8BIM;-printOutputOptionsCptnboolClbrboolRgsMboolCrnCboolCntCboolLblsboolNgtvboolEmlDboolIntrboolBckgObjcRGBCRd doub@oGrn doub@oBl doub@oBrdTUntF#RltBld UntF#RltRsltUntF#Pxl@r vectorDataboolPgPsenumPgPsPgPCLeftUntF#RltTop UntF#RltScl UntF#Prc@YcropWhenPrintingboolcropRectBottomlong cropRectLeftlong cropRectRightlong cropRectToplong8BIM,,8BIM&?8BIM x8BIM8BIM 8BIM' 8BIMH/fflff/ff2Z5-8BIMp8BIM8BIM8BIM08BIM-8BIM@@8BIM8BIM_ update_maart2018_v3-4 nullboundsObjcRct1Top longLeftlongBtomlong Rghtlong slicesVlLsObjcslicesliceIDlonggroupIDlongoriginenum ESliceOrigin autoGeneratedTypeenum ESliceTypeImg boundsObjcRct1Top longLeftlongBtomlong Rghtlong urlTEXTnullTEXTMsgeTEXTaltTagTEXTcellTextIsHTMLboolcellTextTEXT horzAlignenumESliceHorzAligndefault vertAlignenumESliceVertAligndefault bgColorTypeenumESliceBGColorTypeNone topOutsetlong leftOutsetlong bottomOutsetlong rightOutsetlong8BIM( ?8BIM8BIM q Adobe_CMAdobed            q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?TI%)$IJ^iǯ`ɗm1Tk}nw^.Xlhډq!V{wK\t '#[X_YYg6' L3o hT/@#nfO_x6;,>ٟYvNExkM-v=۩OoXer3zּYkz؆ϭ?XKIi#C$jf˺eC%s0>|,O<P_C~vY^ߥ[]W{#\#֟|~Ҹ|,a/#h:rrX!wz/am}i?J~eq#PaI*>e:/[]w>{;J]\Y6k~aGVzWg׺o3Wi583i 45~=]ޕI$)$IJI$STI%)$IJ^ycA UfO~^ј%ib Md=eVbK H1kM`:{ݟA ۵>ۖ~?FFcQXhÑZGze6*k̢VEvAoN:ǐ^N[FjRΧcmy/uٶtoeoꪯ_Sqʰ^N.y}cf_.Ϸd;tזS1ƦʷYF9lF@ W{nߦ;j<lkwӧ1icSFvB{Sǻ}ڶٝq-v]Z/ǰmwOJg7?n6{q%yM}+.eQ94 +f5#)G8ϋ/qhxGOW6ygJwYT{kSc_Z3ّP᳻NgJ/FfGN7Uc8Ӑӣ[SË>Wk25*93ad?WadmY45)B Lїzӏwoz_<}qk ~%[aԖn?)=zRRu$I)I$JTI%)$IJ^O?F`>/#agּ ~S{;_l a{ڃYnoE3:کη .^]i\ʽ%<~E ٬ZwEs[ײi;np&4*:RӺgMeYF3f^㯵]k"uy[g)8]3s\=A?bOy.>[gt.i~UT}֯&ՕVwPȡpC[y5nNmnv3eCMG]z_Amy:_{wE,l}+[GΙfnQѵ) oή'ON}>݄r5+_Z1Ƨϱ`m±IFu44C0i2 Q=?!uzMʿe2]Tm@ ԲA=ޯ~g\L@ՇK2E_I875=bf<~M^I$*I$BI$TI%)$IJ^?cVn8÷[,g^,2+;,wING^ûXte׏iƓZֵ۽ܵ/=>+ cnf vU;}ig,g:.t2m[lwыGJW@9yUٌ1jV=tց ota) :\]CtXV?DzK`qޥ̭yGgMl}닲{l Wz~cxwjqvY/zߣgśy?Y- vљE6֖58?k74*=6m "L}?8˻m>j1Epgb;flz5!˲f.,cVma.uVQkv~znTkfCxuL 6lgfUZf0mv;O_`} n̼L7pq1#mROzﭘG7H&K>edX( 5ZG[g\z*tI%)$IOTI%)$IJ\:EFdHBW#:w2XX>o)̎g93׭A*]wnI[Z1iy=1X[c=lkNGVOȮ2rj;>ΡY6/UvVUv&;Uu^?FzXT܆32z,aVg5̳*=ȲDMb +m=S~çN}-vqq n^o1gCjFZzVFN_Q]՛ٴ˳j} Y]Tցnl= Wߓ_^90Z- o " :t.(MG7 fw׼::mE]$Ƽ>v_ң>~F_ز\:ia}uNvSyމ_{*^Syb>كK>ܕo*rpݑF~c]6Wn+j~5}+(OUfF6n9>e/2LħmT-M6]E~֦ASMϱc70M3n^k[\ȯ,g0:FvVRZK+}7U-vF3~N!}'-?kN I$RI$TI%)$IJ^gY_SK"c}{}r\'qmgJ_ce}&Mmk'?3{ҭӺKn b[YOk(׹owUYoz ےWơK孼잭f5 3z~f;^KGNU,cĺTfzi:Ks.4*~ik^U{3+Ư6G ,6tϬَQ}K0ՎCmfm5dg?e~~WZ8L7U:Wϳ=WUVBg'OÿiƤ'V.emn=m,,ic؎y=9$xxxէ :̜,\U*l}Np^˭/) ֬V`bM{|YNƲ:,L21qMcmeXƶ[\;o%u )bDӌ2lxSU?FQqіi,F@ACysybՋu5-s]7dX/UmͪG`#NP}\"-{1ZKw>2nUיqd )eJŃ=g5{i{9lk)2Y_"n;QXi` M;K>?wZF${g}RI$I$TI%)$IJ^im;e\ȟc{k~Y)9~0>Z$Wj7>zm}Tm,`k֗ov5_fo+:~ӱϑn]꺫Su!>N˸dl[oѲ~֫u,sk jJ߹Ov'>t[ Ie.[o7{Ee_|ztccҏs1=NNq̌IlmDXleUVQk0{-iIOk)uz{qƻ".c> U]_{w' 5??*6etlM ʲkINkF.7纜]eZ9o֌+ɭ}D>kZG%sC\n10Vgqk,-Ĵ;iɄ܏M]Gn]qA`[1qM-p o`uY/e7Pۃ mN_-R}vfmYWz~,]˧2 Q)xy-/;zS#Qڡ`j~n瑣;P^g)Yi}\z7KFG ^I$JRI$Tʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$ꤗʩ$8BIM!SAdobe PhotoshopAdobe Photoshop CC8BIMhttp://ns.adobe.com/xap/1.0/ ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,ICC_PROFILE @$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^uICC_PROFILE `dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<ICC_PROFILE bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭICC_PROFILE ŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{ICC_PROFILE        # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrICC_PROFILE qqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJICC_PROFILE Ӗǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpICC_PROFILE aRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$K3[ ډ@KOA9}>PlEH=Xء'PxY_?~S/x?ıt)>Ҕ4 'r_l?o|MOv?WKB 0'UƏ <_鏉'J:~a*nSW8`o>&l+R~h*HMvD8`o|MOv?WK9-OtiUrqu_S݇6Ot)a$vW1{7ܿS݇6Ot)r@ i]'Uv/aM%|?~oEIߣ'䃸!v 8?įKE Ѻ6/M/aM%|?~oh~{h8%_ -s}15=d_Oߛ,?▏ϝn}o>&l+S_4!+N Us7rL|MOv?WK]Ur_WS}15=d_Oߛ,?綈!BmW >/aM%|?~o]+Dҹ&W,?>cj{7X-Csޛ\gM;Zcj{7X+ѫOJQӇ}O/aM%7X.7 } 15=d_Oߛ,?/6nX/Z"\w->rL|MOv?SR@S*Lj_鏉'J:~akOJqQ&Z}jo>&l+SMᢪi\tS15=d_Oߛ,??<4Bw;W(AírL|MOv?WKFoڻ"LS}15=dGNo6hAW) rL|MOv?WKd%};GbU1N?ܿ'J|?~oV:AG>eQFZ%?ģKI;G+U2Ei?ܿS݇6O:~a~m[NzWcC?ܿS݇6Ot)OW1\;pO*N_鏉'J:~ar⇡6-S15=dGMM#p?اTi?įM;_tWSS݇6O:~aV;OO7T^S15=d_Oߛ,?ҫCL4j_鏉'J:~a~ji+_o,ܘ{7X+G?DCKq&aM%|?~om34xL׍?X>Il+Rq-_%Wrcǩ'J:~a|?-|8׍5M cǩ'J:~axKy䮔Lx=d_Oߛ,??IwכT-7rcǩ'J:~a/ yKi]>q{7X60,IH/טJC>n>ǏS݇6Ot)n/ yj=Ov?WKORm_+T-7rcǩ'J:~a`/ y䶔)[=Ov?WK/^))y4i=Ov?WK O=_Iiq&cj{7X4ߚbcˏ'J:~azb1Cez̳L|MOv?WKjt? y_򣴿jLx=d_Oߛ,??Z`uWk#t_\|MOv?WK'枖|]>73ZS݇6Ot)ZZgONzS/Tf-Sˏ'J:~a~jgsTTrj{7X7+OL؈ S1}O&>&l+R[s׌?zX477rcǩ'J:~asA% ^W=+Zn>ǏS݇6Ot)@ו*[J>q&ǏS݇6Ot)w%_/T-Wrcǩ'J:~aK/כT-7rcǩ'J:~aכT-7rcǩ'J:~a 򥴯i=Ov?WK`X$+5-Mܘ{7X8yĿ+5}(ܘ{7X6}n/ܿ^Xҏ|}ɏl+SMhR_ʖҿLx=d_Oߛ,?aט~KiG>n>ǏS݇6Ot).5ʔҿLx=d_Oߛ,?M<։.ח*OJ{7X-?cKI??ܿS݇6Ot)aɲ_鏉'J:~a3T]}K*7KaM%|?~oY+WN 8~D釥rL|MOv?WK'ҐѢE_tj_鏉'J:~a&?WcOvpI(S݇6Ot)]4tVtvT$*QoO/aM%|?~oP_*M?įM+CLiF>&l+RXG9PwO/aM%|?~oR?Z@LWrL|MOv?WKn/'_?"S15=d_Oߛ,?ͭ,nb_#4_鏉'J:~a5tX?Weʋzjq5=d_Oߛ,?҆̓TƟ0rcj{7X*,漡!Lx=d_Oߛ,?◷f9%jL|MOv?WKGL_+5^>&l+Rҁ? L/[aM%|?~o]榗-x^7Tv-Sɏ'J:~aV~ח*;LaM%|?~o[+OL=9WfTrj{7X4?5t+S?"q5=d_Oߛ,??֔REi?ܸ?įNzIT"ѿ֧S݇6Ot) Weʋ?q5=d_Oߛ,?V'E?ܿS݇6Ot)gJWfTrj{7X;VƕӟS~F*nn>aM%|?~o]殕#p 5i]i?#Sɏ'J:~ahisח*/L?įJ-j_鏉'J:~aҀWfTrL|MOv?WKΖsTi]O/aM%|?~oXJ4w+U1j_鏉'J:~ariӸO*M?ģKzGpiU3m4rL|MOv?SSCH?cN;}j>&l+S.};S0ӏ}O/aM%|?~ohrcCi?ܿS݇6Ox:~a7TNZ 15=dOJ{I%v!WcCi7ܿ'J<?~oS?H L TrL>&l+SgI LPq?ħKGc_֟Z_鏉'J:~a+I!T*#M?įM$uoQ:gO/aM%|?~olni@WҸU2V?>&l+SqmiO9WcOv?15=d_Oߛ,?SKL~^4Hc>n>ǏS݇6Ot)Q2ۄ+5_->?ܘ{7X:_̽>4ce_*/L?įJ+U3ʋ?>&l+S_4Li?įM},?Weʊ?>&l+RV)U2^>&l+R׬sJLp}O/aM%|?~oXRuoWfoȝ4 j>&l+SizS*3L?įJWK&+U2E~?ܿS݇6Ot)aҁ8'^>&l+SggJcoQZoO/aM%|?~o[+sIIWeȽ0rj{7X.O͝)G=|8Tȍ4rL|MOv?WK9?7Tʅӿ>&l(t)OW.bWLg7Zcj{Oߛ,?╛oJ!Wc>wrL|MOv?QR~qi*xW߂SNeʅo>&l+RϤTsQBLtj_鏉'J|?~ol~rW U2C?ܿS݇6Ot)w-#qS0O}O/aM%|?~oqW7Zcj{7X/IuSo1M ܘ{7X"bf#»|<KaM%|?~ou~oNqAq֧S݇6Ot)H~kd+WfaaM%|?~om5tuGUc+L??ܿS݇6Ot)c~mi`WӸ?%_?h?ģK)+'1tj_鏉'J|?~oTI4? L'M=.cj{7X974Q+U3ȭ4u\|MOv?WK>S(E锯֧S݇6Ot)gJ-8LSɏ'J:~azc_/Tf-Sˏ'J:~ak`8>WeȽ0oпS݇6Ot)҉p}W3Zcj{7X65+U2^>&l+RWeʉ?>&l+R[Pu\Ti?įK[IRGq+U2B?ܿS݇6Ox:~a~sis֟a?a _O/aM%|?~oi9t˒[(_{+MJ T`t<Ađh*j־8hcHt8Y]n7+' viuZRFE1)Q6ějx*8ᔍMb揙 +^IPZTTcI\jrǰZOB}ZDj{pZ :xiU1"t1TZNp;0-R 'G}(eq={R6Q*k,?d夔ٱU?b-9N^KӸWC)SGeSSOT}pF*hz UӠ+ɷ⡪H1T+s m,+S!Que|UdC[9a9m3z`9F*,y=ưæ*ʇ] eqVܩ]|r|UNHE8޸U ۩'TڃjmwP@V:b Z j+MqWzE;cjwjd*Pj.1UX/%KVӸ”8+Sѩ?<5;\$M_͸m銠䆭GGæ,* SNkQ_G* h_a׮*C]2 hثn$s[/f0-5î*,|-{a0*X$=~xN*ц?{S; aODE-B1UU_)tWC1ovq1ɠSH؏*DVk'-ڣ\Ud%\$8#*愫EHHJh_jAE=26=0cmtrA_ R5bjzb+,*1U%O5qUd :\hWX8E{qV&iu銨#f/n;t*+YӕJ US >X܁q'助;PZ#br1Ui^K(q% >ȥ1LP-McYOQ0wV#aPtR;$QwĄR-@ӦQqUi **),:R|m$rP1Uƾ1Ub~v2ˌUlp9={V[>;CӮ* :SQ ELzc(vT Ywҹj>#Y=ePvM加4dLc/݊(*T햸NmTSmP7-䧨MqUi A;a|UL 0UVSeMVONʨqU)pę8銢⟘t8aLUBt<߶Ya#>;tUcG:?*޽1o*@]צ*'=qU+O\8lq@TÐFwƼe_UZ CrUr Fw=~pM)VV )p)ǽN0T1:qU@cI`ZbyxcJWUIΛUBe0a•q=_qI/ : 4q0G犥FM5qUTdbY>܈銵;9bZeLUt߯( U %#*R6;⭆5k|Uh X5r/^U+>{I"'= zU E >4r\UW1lEY#sQRFdFpBJq]s6c$*:;qUsTmZvƼjb]Iny+* {8gkp_ I{Ud&"i?V*E)+Z}-dcKQr;côbTf+twCn1U ?qu[crU&P׾8{bL6<cRI8\ʊGzc anqSM̜%銮oN>!߱[e5 x⨸(dۏM/,^6P7I8Pnzm׹VR~9*+P\kNتL}CҸu;q=qT4|5ҧ4m% Ok]V&x_DO~xzB W]UmQ^#,LP ml?gO2MOv/NV~|^Mד$sfӳثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tZezHrsrʾf#ҷB&rzRuhU*R6ώ]  @V^S5]PSpGO6oqUBjrZ{T=GZIN?F1O%늫D0"87.qU'"͸&DF5=iN#EF@ 7J'"G aU[Fe=R P{Wc72DTzrmX?׭<іz`UĤ6 / vxLU|{oF=qB<;Wr5; R]ʻB>)*ٜ޵jb"oQj y%Q TpTh{o獕8}Uk+UD&P\ElPyv:V4#m&6*?ĢqqU'L _Zتu4Vb ሐTQDn;eT7LUZ29m^+Ab/?ӱFQPA;D>O)G{1[Cm*zU퉕\U}#(?C T1ʞC|UM-ă;(_bc!c㈷Ƕ*_0=*G޸rWTDqq^X I5\Wq5U?kBjlpqbP8{u]kt8дF7:⪢ݏP23JZK}ĪQ$TֵVd xwF1T+UlO\P(lp#20R)f5Z( uߏ M*1qZeZC\hZU%T*F$UH}UQƒo^.H/ vO2R)s7UOH81R:ߥpJ>OCl_ QN&֔M*תX,o|C⪢c=2]LUYd$0úLH6Ʋ*:UU%(N \U]Ԏd1}F*ij.^$7 U.FeӥqOxb/RG$t9v+"{?Vun#f|{VL#0~U+Ly=J lN5CLUEӒ~i=Wƻ0W{n'$[S¨kX1٫"qJ>g- (#=qVLoNPuWVt7*%jmqD1QS*\2@1U&}|kSY(hoc,1ҫڑUh.9 68[=iIȞ>,o,xcֽ˿LUliR^T\qQSLPu(ePLU{U(,bd$@r*!iCWR`st{1ZQhWÐV6H;c~sIኪA|>xQQ\*9۶*x"ph *:`T: æ҄8";bLSZ0QZi}VryZoLp;|X"fcbnQ*79JAW25eP Uxw"5A[*9E}VRz.7;~r8UlF $+)#Yt6W$QNH ?1trzu_ۮ,*@VkP솕{e>LqBEsW1J[qP#î*U?f7 Ł&C0oosʎ Raq{C{cxbɷQM=k_6DP,t8s +*A|Uz ic rяn1U? W 0*[v^S o_ N;W["=i)#TUE:k]$NTd&cԌU Ѓzb9G\UsP8~U"WsqF*J 06U}ǃNHot8WT/#ڻW3t]A!wbl¨f劶#3Ux\Vq-0ߧ\URku$R^/ݝJ`9a1TslO9'ۋtT,>#,GzAPD2t%Xu(*n#ցLA^PQ>u$Sܱ-|WmT xw$lz`r fS+pdH|=0cx5Zd @ 8DYT{-x\UlG=)⪩qF,a*K0TwW"Vn'+T-͸ރqF(>1T#TqæR}UI+W:@ ,R%k\Upuƻe q!.鿎*Penj{b @kZ僊e"J휓i9V`iIsߗܿ*t(ד$sӲثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tI^R?\\/θKE b979G6{JU;#Q8ߙXտTNNj G iP)I9tVMjb›qUۙ (=I*%QS8Z~*' >q|=qUk^?o#0JtW<0ԯJErNEJzٳ+rUb13v9bVdjI6>#E ^e{V1U@xȡ59e+*w~*r#}KQRP:wʗm\Uu=9>P]sQZ|W;(b?ZlwR)ؓN8P q|b]kX{\~8ѭ2?|UG.`*;7cqW⤇劆,=%bΤS+pI>,vlFI :SL-M؞h7jQs0LUdNG"*D8}ˇo XƘ2'b׮%B7UJze+(%cb;xlQ\?e4; ثI^8/ DE'_C#U<ĘkF+8$Zt'WnLFw=04Mx_⪁E6U%S@v#45 ^P:>ˏĸ^pYA hL]OՉ2#j:cJS\UUe@\UEы1CU8J v 8bcJ򝶧j⪑%XC\ibk8~҂qJCߚVeԠjh>x#T\UIeen/u&‡D=NW\@ҘU-Ek늶$\-}2O1-ۯG̱nuq`T x,6Oo R+ѱU7![=Q$P[.+Rl QG!ƉX1UZ'S }ZoLl ,bDXL*4'VE4ʇlUQ2}87.qUa|{О\:ĝ|Teb> cThD)*qU-(M~j? }>!\wbdCG;=늸\8S0e'[xU!c߶*T\V<:e}UJHe{c!⨋{4CNU+O.-}U9c%xcLUD +rMB|zeŸV5K~aa:bxpmw1UNAmc'cmj|w/RuǏ m߭2-FA\4۾*֔ˮ)XЄ) Axx aZRYwk*Tt#8j|GUE14?7=ؾ9:q{wr93lflUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tL@u#!?ԏ'?/K|OW+?,u.iA׌s ?enl*ʠ7^ji?[Z~/-ZX*¡vq1助2ojw+e W+\Tƭb4E\(wUTcJv<銪%;m1Vm*H2ר۸Č]N¨{P+o-4\ۮ>lU P C7CCMr#ۮq*΍, e0Vh]&@;UPc )T 2`vT#ڧ^e?\* bޝGOq3׶(E/m)UdQcFf. I)D:~boMPӱ(T u늩 PG\Pa')ק\U RkdS Qd vǰz HŸ>Ң\Rbq"026}88 +~A>U{#BGn'CrBF:raU0)#? ab4mm=F㧆*CLEwR_>ت&CYZZ : 6UMR7.&*HH&XPq{H A)|<2o '~G-umh*]NpeÌ 'nحuo&"Tu=5=qˮHt3q'dg$5&<*؞c}lq |=: ؏؏eUНJq^-N*tM`B>C(çLUE*~-MFثfEY$ UMԧ?#_We9|SbTBUч|w8Ҫ~4zuUd;oQC{c$(یUZ +J)D{dP|TB3a߾XqCC!\L\1TFv e*Y;E5*A L;!" Wcm'+!4;S60*H .ǾXn7Vf[|~?`*ٚS=FP'lUtM{TT?AUJ~v=jSZ*ASGBvªqIUF_.?fm5y40" 71 kNLxo КSeZ{veF\$?,O1J$Jh1UA"\n*]Z%jlH7LcC:O; ZRze\U)nqU=*홀VJ_au*aN5+Z%TyLUw2j튴tUbIam Nn8/C(تŭ4<=N(zU WU@ۧlܻb}*nO,ZBy]ZRNێd*UMci㊪|V,U]sLURSvt4kxk㊢mY>?C7(;T/J:|1Xۗ>PzԆ=~z:yyF1T>Up|q^_,UMAV@Ҹ@{ JEwQҖ9qV*a<ߨe劵 *~Rb,UN=16* ڽ(G^pM9xCZc'tGV1U%*P4Zeư5UbaOᖯcb9rFOĸBQJ¨MIe\ b JwǬC=V-DzSTAzU)^I U)y;^c:o⪣NxcU- ҸqU+(*_깇\7nT3~1#Sc\7˰JNRj@¨ H܂HAbc*E@5c\Uc̪Qצ* EfƓتBGCN;bzxe8K9v*mcCu¨vƆ1lUsFHz|Z9+x`TͿ ;UN+P||F43'zb8G!j|>?i2MOv/NN~|^Y(C9lnlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tMUZ|Y^#!y0rB" {b2m2$SU. E@„|m4$Sju \RHq#u튡n1`Pt=BȞ9ЩFU3SS8ki|߱GN]i U ڧs}6 (ت*&@ÐP;،G>*Z=*zoHc:˽G\UF) Pӥ|rMG\UNeE_잔lqU'SXS*}_ڃ*A=|M~UQMTScn8Bb7:̥NYT^G>88&%SZxXnbthS8F+)+e@).|KBBjlQARdpُ+R5߯kx>dclIzVVӄ.Vz՘ԓ/)ښ)-gW?451Tק\R;6˭ r;ޏ;Nc ׼ i#E[ 5d cBy)bmqwi5 u{ی lʤцAUaScնyR+LJ8FW,Zt8ICEGhZ>L7OcTe | :8bLNV犮~.(6QPN\{e|>㊢D?hut Ur+^(md;1MLU{ƲЩn!ql:}F*qTFTm;fb>Uln)^TV'N#*^mƿV>^4oQH^2M6#^M#WTZ]A/qVtq޸,5 1V`!|N7#aM}W(;1T۾BOb⋾+ UDi^0wQrQ&ULOqUa䞸)qURGLu7TPq")N*3@N4 UzZUVH>UA ߶QPv;d8U0YQ"Ӿ2W {{t[}2ثqJ+}FQWb}Jцž,aN=8]f2x*8Qm*"Հt&,RMО&҂]*d(6=GFg늡F_#U=)Qy9PUÈ@S*G =)Ӯ*j2qUɺaU:7\Bk^65Lc UZ9 f {UsOz-O|UJe&~xpM A@ٖqUE*J۾3EY_~lkX4^ (Qi@UoBj1WEgrr/ y+?7=ؾ9:q{dMǓĎq:v[vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tr>^#%H.õc3ʝEX)/CXz-_P[&?n;,HGcP0zӸQNd~ = qN,v u \M5?N171J$:`jhHc`A#cb]+X{fL E jOP:V5]VhrWkes{Ux9,xQQOUZNJ^]? @Lb/#DcIGsYa?*RI +7cW~ت )>VMP&~*>4 P5R?'l '[>la"S|O1#\U jy@acj/O1T\W sOH1ܵTlJ 8yaӮ5_ǠU2d ;v)튫קL @IJo h iǹqo@ A1)DI`{[*#B N¨UiEzb4nLUy1VمGl\U|&QPq)6aTe x7Ĺ(O_`*#|qUpH6-F*F? l܆*p~_:CbzevۡQQeE/0UqU;GOzEN$mkRRi_F3 R9?Wq5jv#Eወ:fG 2gn2Ԭ-i↊ Q-zQ%=KzUM_2b(qU?Iyw_jOlU,^0WjZ59F .9¥>U ֤3bVxW|*J ~φ$dWlN#Y$1تubmZXަ+\ h+if\zlk혭qV^'bŔD횇|UpuZ }c "UQM:)Ir?,0mV2lJbuY>0&WqSUNe=JJ/\CLmwb(UG؏lm>UT9ώa®?xl.ݎP%~![($IQ ~rLUh~ǯof銵J٩{AP{qW.30劷#leYN1Unʵ_ {##>MD06aUUnD|2|*ɡYAqo* -CJlUU%G6mŕ9u\TYzl)Ӧ*6,튭UR3Mb$n7ưTF,:]sT hrY*82W#q_ö*RZcf0=>^U] E zv#.a*(zψR\Q PnC(1U; +U lk W Eo D=d_|Ucb6QqCT[P*p?g*Y}m'z+CmązWTZ d-*0Ph7ڴ8% ;ئ |Wceq#*U\Q犮G1o({⨕JAhqVCNI;cLULm}J1T1VFv8Ҁb;Fʦ*řNtZM:Q=iSW~$8AUwU#5l wV̭dؑY ۾5\UR(}}}xe6:QrJ17asҵ\*.џ0*BTb˫A{x UW+҄b8mEs)tuƘ銪%,Nl*aVv88jV1ӷ|*nkLUMǐS+ >r;pheVr8(vڸڞتPH mSN0j[x\Eֻb%;1Q =@ Ҿ<@ USzԜ|o^bVjWqM霯?? 7=ؾ9:q{qbYG9m;)͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tD2?qܹ9Z_{F[UfW.eI/2PvhT oE='U?hv=⫷Pzbٛ$ ^6Ƒ_ZH RjEOXRB76E(A!Zo_6DZqJJ&b=Rzxp$uQ:-j>}V+ xj(ͷQV<1{)%~㈡F =Vm^⪫@BWxb|ޞ8Phxޣ1Յ&M੊n1BHW 7~85ߡ)c*xQ҇<|G|UĠZ?cTi^ r@(1*'&⦇ ɍy-Mݩ]Tz4F;Ƕe,POLnOo*t( fr ڃʴ銢"JlcGM\U/F=$8yD- |ʟn*v=ve I7#q0/Pv*S"a^"~?w8;~xp-kʦ ݺU,<:ц871U5%SưUR^{6:f*Ԡ<bJ3T:m*0 W~aZ|U$7w\<[q0PdN1x8&9E™6#4\*90S#~RGךw;|{b/~9hbsEYi ap4銩4{c Cr1Ur?Ql*jo;mUu+LP9 VD#08A@N_MUAlqUC^E(zHp^4Ǯ*)z׎zblTlN< kJW|iLUTU.2Ӗ:3r 5Ӂ(l*Q. TxuI)0*_=Aц>ت6!28-k),ɊH)0jbeWC1Z,Oư=UXRlUz_,Uw]ኯqkCʜ **!{c!qPە5;z[;c1UEhJv|GLU@xPb_ y8)d "?&\U -M:euE(qU"J0تmSjbDQhMQ5e=F*j$˽qTLs8ֵf*{aU @qqJ@e=2nP2_''#W?~_/REƃ%6Ν]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t0%v=Hrsr>`.haZWvLJ~Uz}OC2*;uq%X:~0H 4'Ol*1U ā^u.`특Sj?##! [d^H(Fnت[]bˆ|Bqhx n^5ՎM RC hKn0ۨ87b;fVZ,MMw<5={W[߄b?X% LPt(e[s]^,MCて*PYղ Mm$+їPqUev8ڂH=*pxdCELq'0r)nHǪބc{U X|]{f)]*܂Acڸ^$UqxcTS "0ZmQŔW)DKdA޻;TVqB!UU+Jv&تU鉑]*Ž-Uª|T⨘V#q(^ؓn>UcZn" bHcF:=UhdnG5U]WmOp-VJh uׇӌU|?}RVrl<DTTدS׶4V9m2@Zj'L|jkFa ԭF:WBE7(M(d]1ҕ=BR~}Zsx&M\`,zi̐wcFry ޚz4yu&C `]j2=0X+q tD0wPv'osY{ŏHU NUeZ7 B-djZwu %e0@*ֲ4¤pW7WhXoA]돶C J{ebODQrֱm'G~"%/^پÓSό=ra#:N u6%}!H䎟w˦u[.BUldU`\D-N*3q~],*@lkbxk|US*5NwFSXՀ ;qWXk4#|UR7dlAҝT}嶯bmPk QI׀Oo;n_4vy!AxUXV튠Fف}2銵\8UA'{])5qV J Zt;T(/|UkBqWčyDWf銮&q⨨.ĴӨª҇1;Tta >VP(v>vN"u㔻v[p]8b={ק_ x}VQ| ^RTt'lPڊ5q•lثd/5es{J@= KkװjwV1Vbp0m0Zbv56TG\MvQ=IaweS!%`OLPmӦBXי9U* ^+s+S*Ա;튩% XX ҹ#*p6 }RJwqA'SLUu՟"(zVjo+wUDYFjR*ON45ZH늪gbrэAfZuYnpScW\UJhK'QڸTT`faNEm|2nR7R3m*=A#mRl7,lwVQ_kĮت@SCず6|qT;i==XC*‘<ly5TUxl7 D*mNa+1q4\UE{u*\UjhwlUdSl(qUOPҽiun FS*늮e+N'=TfIׯ9wbR}Vdæ_*UkE*:pTXa$U9L+[۪rتFw˶ثQkF4?$M6Q>+[@12u&*zH v8p*K̄S*E6«|^+VȫWƮҎ,|Tl1W2zvZQJClZ=A]D(qU5 [ddN*)'lITdj%M*YG&?Pߧ\Ut_z6lUE+5\ULc+ኢTm|qUn'w+T AVWfb4؜5l_תU^&Z2bH1xت]slt9e; Є\Fu>9@«4;ώQ1U]o)&͊qeybO-뱡$s S˗|US1lT/犴z {N,UQI^mUy94$vZVR@mel:⪄4[+MVZ5ĸtQ&NKs~{u|Y'''W?~_/YD}'g#ͳdWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t0b:R?\\/X5+!P4?QOa ǧҠ}TB=Y\Ut OQN/N*VPY+~dž# mU6_16ۨp-ҽ3Q/Z?V BIgK+^¸%~1Tr"={sz*(-$ԁ@lUЫunew;Sj_R>kF/cއcTbb=ץ;5aUKbDۧ.W""=.8/H'c#Z/ ouPo#즯{u*(:U!%!ZTc(CF;b7(⠠˒**2WbkF(DJ .jconzLf8=zbMGl$ mZ9T(||q$RUP"#ؓ;b-[sx%$eۅT`^?8CioFnFDasKFY X[U+>"u;#:z iH/*@'Y$s=#!vAƽM`ìɘc/ּwvMԖ#; p)RUwM` "e;}J )aA<۷CAN5*WxuHQUoc@1W S 3?(@*p9Y*Ҷ\zfqU7AxiR:{cH*'x{k? ]χ&j>xU_c{U)=>SGRZR8Qb5YzUܔhO8q5I_[Sn*@ ;qW4l7,sJ7cCi*;G8*j>Uo(toG!pޙc^؛4 ׶DBʠWuW<=]7Cxe_T8ԝ˯ҸP;Qχ8mT e׮(S1q9\}BNf ]*%>q˾(SL m;f0\t،e.NJUf-t)8B>k)1UXS9QZoe Sj FEč`U/TǸت#\w\Uo/*N2*6usv;ebl lz튨*Xt_UV)Att늹ɷ\ԨZFڽ'"+R7ա4#c-N*OE'a\U*bjj71UOI\TL9|U'v5O2QLIwR:⭑ b/+CKh%REzpUC (QӦتK`kC+l*Pl)O늬XZwQDr2!\U 1LQ eYOk> *P'|caTLӗOv pGJv8E;Q'q)b⣃ {>*p<1e߶*W2;ߦ*C2zbdcOsmV*opz`S*2r12:)#UF=v**7 ~iZY=NONتa" Uz1]ۯl域i9V`iIsߗ.#6Νf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t&vi#2KtWT.-;ڹ%=|FgÊZ2҆{rfGp6R>^^U7CUU}eP's|qP(=T %:qU::(PR=6ԦX+zhد_lUmͧ$6SCT0O~N튩Pޞ' تX<(:jw .#@H巎(oR32}+VQ$WF*v#ݚO*ߧQk0*8xքl {q>5a~Xꄉ'M\sw8jmqHl*ug5`Hq)^/˗TW38U2#Or'C/ :U9h9D q/6|튪ZFny!ߗI֤wT4,h'?^hPNU0 j҄xe4XЯ.D:|UM ҇15*z~qVZ>J|}*&2'a6=TL^=16TDZaUoJ&}8&$ t8Ơ+V#K*K:_l%U,;/Ց[ JMY}!A|6qUE5 S !]U$.UZ;HMmTQCBnOJ.%QimKp"S<#3A q/MLO%El9ͮ'v0BȬO}S Q?je!r@C0y+ƻz.ZhfZMX<"f.lv^k1bk㺖knQ]"d6mYY ̧c]|.AD'm<ڄjbqEȜP3rGNgx{jDz }5 v/*RzK"FŇ&WrȑQDz9|uv @ĩΓb6S2h)p?q~]6%N2CEVP kcBőLD}oY!Cѓ`6H-ADeHNc#ubN&-moJj;v#j'YH(_ ЌWl;f)]UϿ܎؛QQQV߽z M#D%9ߩ?d5 zgnlju g+`Rܕ zTGV&U]hz =b" *3-w8I%6q1AUQUU;|KU^KӸTZ>N$bvEj+Cn: *79 C&AS|UXPP*.7_J|_.PߒmnޛU{Ê}#AZjĥy~;2BGĽOQow?LH|cJ5,۩F4b UQ[nH *т*>늨Pኮ7~69*Sn ocqU7#1lhmR٩LUUEFlHG`i[pܜq gٺvˠV$.hci73P͊~xVmT7\*,TuYCt1W\UQ\+O|l*;`ӮSe-aqU>[0[fL\f_4X'<ߦ*') 4UԸ-늺6qm튪F] EFq`$[fŐ銠&/*;#Q [ uSe/]bɸ4.,X6']:bsYZ)h!WAp+鸣Z&+n0Q |>x$7雙-"/QX v¨ڛ;|THz;ss8 )%w UFU7늩 ZG:UlZF(h\UR9qUy59e6(ԭq`TC"5TeWcxӦ*%he|NUkP2bB5vӨU淊s6;8RbӰ=~iUQ.љj8J SxjzP e5n;aA^ثq26o|aWF*x뉁 er^=8u3LU`~9_zo{}ru?AM*3Ďr:vSvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t5Ni#0n9}i>{}h<~!Pl#*;p)0poϾ*B6߯|1me} |_OlRuWQȝv?lN*wuxACũ:z}jx-c8RZ._}#q7^(PE(~=Fde+c>(D2 oNeAlp%hDdX;c ŻxǬ(J?~բ\'ZQ>>}*YK^&[~wQnv`;|LPBgӱ̛^W#Zm/XiAeqj(j|a|hR'; MlU:ufM׿z鉐ѝU+h(OP{ k":[v5mU%…jkUt1VVP>O(*nhjU9El7Uj{OP)H>hmQFǑ%zat>8ֈO կ^7\U*8wS\L*PVưUbk”1`vf4+1%m2LxZa=ӈ-#{'yG~9lc[$}Jz疔qBhq)\VgjJ(ѩQж#nޝtޣ_(Cy&}I8ANʲ[2P!dCTh_NoL^saAYPU=YDxگ JPm,ɐI45)],AV Wr: }9#4g}߰#6w+B9׍q~hu`E,G ^ 3MzR u# ( y lmB'Nu">XؤmĀHoVr Z85ԐZ/|JI>$R  7|悁5gࢰOr/3>Ao=x-.Ό>nH"!B5r,Ǒ'7Y)^BB<3{ U. LQRԝxSŐB)Rm㍶|FȄSs-Hh隌&6#v$W$Zb6)6gc[%u>˘r7=qkk"?}5 kk57G"E0bfy-gָӨ8 ц$@E!g]&T|6򛒏*3=Qژ֌GTs.q^WS$}-EEL J_uep^A=F7u۶*KV]SNU654۾n[LULlUǦ*F:Ӯ;cCs*bƔ1UU[nVuuV$z}5'l* _(bqU&JW.UQzeM*-z}8튩2gZQCpzx}9TbVnι\Ud{bԁcxqU9~aztY*7Prj@ǫmCRr3Rh WǮe58r81RUdOZVژ#QzbAGv9]?/N[хV*>T$|cVTecoTU!eVҘ87ծS b)]!hݫ\۱]kb8Ub0}e⪌: cUZvFeޣ SX@;ze8RAU.!Fe (~P]#qNC}ʢ/-]_,nQѶc4|UR4xj|%޽FYJ1U57W\UG Ƕ* *Lx(0*p`;u=~xF E.+t@㊩Pn|r⫖`vQ\Ur^+* V4'9?ix2MOv/NN~|^\Ŵ8O?gN3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t!~;wG˓f`ܨiH?rکPGL/`vnTPW*M;3)tvkvlqRXoR⫣~(ާ,p!NN=}#)ӘU!6z~#`S!qSU[iajVbCI*#sCV~dJGː/Q8-@.=|H5[)NGQRP}إVHw#GqX B%(rj(,W|UL8)4%fN|\f\}Jx}80UNSY-~1 LU}e ;2Tw: ٹu$8h1U B>7\AmvN*#ރ5Ո6/S*[r"qif@iNږ|gu%;Ҵ)uIPVkB[2N]˙ -ii񈭗;pi"v}0;LY@&,znwR)Js{v&sA:0@ۦ+em%zj j =lҪQ}!Yor"|j3kh,za[TZt4O7/s<S_ y H$kۏhd|W+4j2/-,S oNtAXv1fm:|]|d 2*4# j\@k{]4VwÊHZ<1XG! rkJDrM" a1a2iz#~0o_r/bO4c>UT>7p$4>~`"jJ,cOҩ54%֙56rϢ7߭}O,u_&Gkk˕WxYy2_c!uk6@™d.l,S^5#z:H)EⅪ#s]) Z`h]=zPS`Iic`vF27ڱ냊Isls 5"KMnW$As[ @;`ɔ/fM(2Uhbsq"vm5 ?_֚5A BY0:hF>'[!N$%uq:a$m6 aSLPVrqxUZa\Ux8aT/QyqPl~mlU (1 XvW8AR(O<}T:Lq팭jU-|;⫝-WqҴU'LkZ+զ*RiSOl7; c|[ت"@Hb2Ou¨I`aTu(BZ{e)'c]2grq8U;,xNo7^늨B?V_MB͎VrmU8늶Sz3aVYƇ||UEMUlv N*GL eqU [T㍭qUE@U8|BHo zȲn6\ǡV4"lOlUi@O.Vn70\q|uqU.5$~* q3]Vq<|s?N*^_~g(ت唊xciC\U_VF2T态np1ubt=:cJUY 9~تεa2W[қen:h32tR5J9\LUq_ ;ƴ@UZ+GbtG\UMTZU _0@Miƻ US}(=U7&lOChqUs:WcA>8huUKoS!Bjv;[?3&S@=FQm6;ԊS7-qWz'an5w*>X?xE*~*Ӯ*Iy?S-v튯jF;b'M*U`⭋hz^;8y1E۸PnLcR?4U"Z튮xִ盉h]zqREF*A!&+ኢ#ңq=W#|>5Ʋ*z;!5_ **v9a7V<\ E>yl*MRUahz߈.+SتXIw|UDJq1UIhzb{eqTTr5hz4Ê^yQPY:q6Tc`nN*IQ2[ >8L*.Y XҝZGwMP;fO 0-(P}L[jx^#<֊ E{tdg\F*E$<=zءT^>#8j{ U|55<mTߔD@2b/ In=6nH=3Dj=;/*ue$M?Ljp*ȣ1g#_T8qY;@۷Kߋv„cF ;&o*v,*AMfN[j4C,*|Tg*>ت2}@تƧc_qazz Aǎ\qU ؖS5*vIùN[b;@Bb5S'pqYHޣ "&$9JhJQVW-mf}%2q> Pa7fq[\U^dBv(,|_teOQC Zd%@{bIc me |UB9#P(alU^)=Z8؞V4n:b^jV(Xq=]qUjԍݘFJ}>Ak\U~\⪱1_+^Kt©ȸN2} khݢ~'uF* ṩN8+8?F*p6Td@S'Ǯ(4؎TL1V5|Ulz469E@߮*>8ѶTm1էL ¦5*ц~:Tb |rTe;k]Δ+(AU|ثo8j Zd>!S#mU0h(W*IM,9UdqԮKdzSc:oTU||_8 uqo*< UEo˨qF*%jmƲTtWEqx߶0Q=F*ba<~S->xdv=Yu=oŐTwRՋAbG0#qE'0u[.#^ٍ*G|UwqU`7bSm#lUnGLiAIXnzS>>08x9]qTƝdKi9GlUw?l1^Vz,9t}2F4 :6NJH(~*8jV>cQb.GqkRxT(qF{b #-<|⫔3m x1TL3z+s!M2 MN ^1T#Z|Yt*= rF*olUcyR7=Zrn07qV:~jثh֏:iZ:⪉#-@=Ga1~4>~wM}Z7_[2=N78kJb&Pvc\U+fbScQ59Fl;7N_* N~Dm PqUyvT@QC劮[;݊p^u=*_E_W,&`@t.9 _ u=*UR啮*\'zcM\UUA>G]wRAV1UU )SG7M*1U@M6˥qUP\LUtw^inتx=BN`Cn1TVsceDG(+CƻLUtq^Hy/i UD\vƄLUXia* oolت&3S*銮/ʡtO* =U9!ۦ< 8ɰ{p ze2ᔃF)LM)LH1TPNCQz$eTmUY(7rRy:㜓r9V`iIsߗݿ)I:D<#w6]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t4ri}ueu+Y\ӽ IҀz*8qTݫmץ:ŇSJ#ӂГN{6V+hIS^db#1W\Ʈ_gM\Tt늬id"W,4!<c_l!*1VFEI;:h۾*݌ͧMcA6xNU2TF=vU ƀ<#e#- طb;e:t*T~Cv픬z"]l)7pkѲ CV̭]j٣ ܍MH)"KY9 0a)A($r,0SdUxfQB0n!&vCTxb&!PF*48%$lYj/ e28aǽ;)T\s2 &W^)CT|0**a9U"Gs剢$^WЂQ׸N}7mTmWFWVASZUSXA:V7Nlqf=!ڟ<qw˄{sg?aӿyC${l]~>LvvQqc(h(6"{BċF҃剀!|] `«\ǖxGb[EI#Pwx h~EXwF ksirA#K`XPw9c/ rA jI"mHȯ }{xe7!2 5[@&xeVJ9AU$ ߻?V Jq0Tt bV+d,tRj\J*a!RvL_(PxN_fbClCM:IO, V5P7>8NT?ArVL| ʼv6UQ xc*V~-ǀ㌆@q=8 i@;X@$>]IN@61v SF CTҘ,>ɱ܉M)HM )QضSJAԎ˂~Il郭\LV={Pu<9%!)_mYցcRmɬj3Y Tu"nl$$|skb|?̉È:~*65dQEde} ڀyx[jΘ@_ZZu)"(:8N8G|UU՗uǫv8 `kU銯RTAvPUH(L1U>!v6Nc^Ǹ@oᛍv8!B |IQqN&bej*!8?Ľu֌7U4"q 'WYU2Ќh1V*TqT;bIצSQ^;6:ɨ߶*?o)C.ƕUD(ኪ#sQWkJ*qVƒt?59|Uw"NUB }*C:1ԧQPEW<$덧ߊkTF늬mtGT.>#=)tn{un*L=UX5+cצ0 qUu0zaUjwuG*"qy!d=b/˳eq,4늬r68j7qvTA09m׮*'cZT j68;{P8UT[lf*˲5,v8mOwዬuRm,XAFZ[6Ri\bƑǦ*%ݩ(k8dWe2*%v5Uw튪LwƲq;tU"HjqIF{xeR1UfW}Z?R?:d=Ueh DFܩ 3#@8/@%/XBH銫AP\iUwm|u*ifd)MajlF*߶XqUHQ2qW2 z#r8rٶ80Ir )ܩ%zQ%)w)ۮ*?@s0 Vf>4*c<*rqtApӠ_lUNJ A!PhéSo*KAʎ~xRI2POe͊Q68 0i sP1lU{}}kS( 1 TZ-غR[8ֹ _{}ru_/$sӳLثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?ttri}5?g'b?o>_} sz I~F*RTk\D|T`UoޫqxUZ TU5/Ū{u KnNǪ {r_6 l5AD,ydj#Ɵˉ#SP̏lUq!t;|?ylp* ʥkhVNcބ8mOC`T%, Uޟeq whE1ֽF)SYJTaWje>c\ђEM}rM8!tloR爲sG0%ftC")6;aTˋ!щ۸2{W^+o{% l|1UCJ;qo*FПL'mٕb+a^?⨄q%c`wq*%["'5=1TdqPTrٔj8Aμ~*Iu?zWE TB.d TF튧12W;7TU ujз^C_~uGamZbjT8PXJ-?pw_*\/xJ#9Zi&?,[[oT*iAM†eJO@vlXbBQeܖqeMAzЍI4o`^7 ~|ٮ˯>z[p|Gsdvq3s"idy+V((=,P{D)t!rYUɀϐ]eMp!.Ģř*~]6p ت\zlrbtċR{q"=pQ{gxT"RILŮ..$S;o9jUDmWއ*9($Rx{(qT3-n1P1U ^KOcӍG*s҄u_Sb\$ Ӷ4 UzD+⪛)1Z_|ki0aIy/NUzR}{LsSn0;Ӿ*!/^Ǯ*jO|u;Vw^Wï( G##<n>U@c91VA^jwe[]ke*89uV+0bE4UQJ~nH}JH6#,UJHتŷY* "(]1!?\\-IR% |XҜw튫 D{e銪Z?u b90;{8qWD(i_W*BUWbAb1TLh*7V1DP;z⪻mA|A[aV\P6#wUfXUGAZbxC\ 1.E I銫 ,kSL\Ul,-hF578R$=1ڿgVv_)K/^*ۢK#qtwP4XP*w)(lUx4wsic1c(⫑Vc2iLU MGO|Z/0b3jҵUZ-QZtW #QZ [?*t آbY nX⪨|snE*آk}k|U nLثi>r߰Bo*F7Q7?Q]W$Qcx⨁&T\*de]C?aQv8كz2quT~#T$G._aI 5jwMm*gvk'ĤQ#%v~8%-`5SSLUif=28s^wi.S<UA]sn1Vqծa^QlPUiG;Ťv>/~qQ}!ftdRۨ]*x 99V`iIsߗ(T㹷t6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?te,á#>Kو/)=va/iAU?ف ӒP :c+ (oqčJUPжWvq*{b[js$uۡ* }dIRƟV;zuqU t#cA*SB@ul8GՌn(xxH>q03ׄzef zڛ LUZOtbT7Cb۬C3)$ҠvXbxT5?5kѰo8uL~|l1Vd5ڹS<\v=2mlqUF1V(v1BBvmq1Jx3DZeWr6zJ9YU^Htĭ4i;1(?,IRWy^0gɠF=/qܠ+uUy9//*#ӏF`]>KI|j }k6 &";Kkg"zU!-qNJY6 ' cL2%CGPm\n]߻U ݾAӘS-/HȰZǖEugla$E$\|-RySQ7G=h|2UPDCjyb@TnM𿩹cr!+SU ۮ4)lzm_æ-00JNV,n(59#GöUz =>,9%h=ƕ@ex$f}|GGJ]쿺V|9&,`#Ğ)4"nݕU9$)7 ){jW嶍~5ڿcEō)C׭==2OMO@,wjjkCh<Ɲqǩrgf@iፕBLhwp6m`H^8C2ӭ+]1QPge{%sFj|OKQ^/8ۦ6E+*NnJbNd4LUYnnT銷ΦceŊG)scՁ;XTO잿F(w4oCRGaxc1b0S03&D2Gq 6Pڐrs*4qOE;wPo"Uf(i'e44DG~_|N5E)NCbqT;D$MczUËwʭwn\Uӧ(銯mwb;ثF5&sӦcM+MqWn v8*1Uߋu59HUv9_*,Ө܎8lK/ݍ+C ye5*'fZZ\ bmND4}*583^ت-eK#`ƛb^v*1b+btg\ֽ4Uzg7cN銩ʕIq&fl߶*7 seqTbI|:CEU,^~.PzDTt#C*sK=EB6PfJ҄u*UYjV6&"0Mv9Ht],+l@1E#C:x߱T`U^'Jm\UaS(#cWaᜋr Pi9V`iIsߗ(?9sn٦lUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t]wG˕+ZfCX̲ ;b^Вn~LrUI ;c,ĿN*l߻i׮*;SiJl;lI5NݽUAjTDFTTE{+ 8YVIi( QU;Ppf5nVUV!8D*c_D{SS;Ņ iip2n ĨVm_GǯO8K?k.(6P?]mb%NGP[R6&/oX ⟴?PXu9@bJN6>n7#GB;*1J1U[VT5N#PUijf p)׮=NVhOzr]\Uo;nP ^iD]+sq ^kw$h I-G߈ۣ\q@*O\B>fz.'œG8ʔ o(Ė=?dm4akDS޵9m:ٯe9 ޝin$7>}Myר"u}8BݫkąZT=%Feއ^zZɍ w.)(by2E0>Wn Re);捣r}YP ӯ05:CrpLap]YDC??ၷŇ](,WTd]-7ӗʸM2lR/:q+|U7S*aH~xeB֛U*CK{29L\UR9| n~ث^m^rWmq'v$t?ۉslqTUE=1UmPw2Schn?QY+{eax.Z#J|1)"# EqqRe{4OLUNHQuNJ Wz"qU7u9 .amrUz{f6 #c*|"*VWsöWN#qتp ЌWKت=*hN U;Ua651W;T囵N*4_1* J5ğ*АTS쑸C;bn*3PWw&R㈨ޘpye82W]p{W+R²q*nF-%|1Ԧ*ﷆc㊸nx3_EqT4 ?a*UL UÓ|4<1h1UDGGƑ#P1U{Z|U)=<,!QPL631V9x*{ Sn2C70U1U_q$>E|1Uj li;b85[U)u̻ bpMX;vnjɆ<.*('mUR޲'eT[`)SQF9OlUJU ׶1u;S9\H5v; hUǗOX1U2'} bpb!Q+?18 Ǿ=ehvaMe*9Fz=qT swzlgcPil6*33Fh:b8T; 048qCȲ@iJf1h\.=1U[{z(ѝbhj=*l6#B\E-.xB1#G銨k Yd7P[InIg(*9be j1TJ\([̠t8Ӷ.QPU6TwG*!ɡ4={gY''+W?~_/'E<oO9wNͳb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tc3 OsLR?\\/qЧql;8*+ʡ@__N_4aGUBV2h@?<^CaQ}p*DcaɸP5^4Qs:MYOmzqU:t?,gŏqJbS)Tw늭BQb?aUo QK-Wj1UL@| Ĕ`wn&PTaV AuopDDҸ+POqSu? V{rĚrqT\dp IaU.nV"9 d1BFq܏bdsvx7FF*?Xy`;54EkXmi5@]{b^yKEL6℃Ն-KPo'\ƖzJe֭mm]4|o$1 Wwa^KlL;ICaJy=dѹRa_Ô^Qeh^OT H`CsH]PpFp4> SYX!-'a0QP)_\d2NG]7_`k^Mjm8iF-X@' %;QG.D~:? ܀u|,^'Lg(~ҏ CK|dfqacҟv8PIu˨ )bhV@~/[vVqL$K3Z+GDk^hZ;xh3k_tR(8cA78t7pͲ+/)$+kyO{aTgi4Š=߯/3a1eUckrz+]OH0@2j>S9F^N9E(i[U 1&oD9׏SMT ޕYhJSVжiU=c?ki%iN_e?D7Ց~cSJׯTKxWGS@@ƛ6q~;NV!%wl)Ji0S][ǎ!* ɳ؍7n#u Z԰;aIZoV\")?%HGR0IّO\Gs ʅC"BVȑFPi{m#p# T4S!9 !}_ `Id;ɵ*y7Sbas( 1&ʩ۹9t $6Uӽq#( jj~A-zcKk\'.$c_li Q:^6s/iO ͨ+5|*NN(YR'ORpLe| ]0F!<Ēk)_|=)AWJ۹%Whֈp`?lKQ1 -ٌ h MvA90 WH~-(SPz1v'%%A-Ab7Q,l(rڹgS!arm@LjA_< "ٺ)o1Յv cGJUUzxxbl QhB~=i~bHz:إ1T7"NC~@߮8U&^`؎d8⪑NCLg:bޏ0)DZ 6*x/mi^,dc*g)6츉rIQlKb8V?PE݊M(4my5[|dL@P G㊯FAmߟCL|UZo%wSQh4R2tƚ*0/O ,DlzaTdaF Ӯ*z+:p~zm*5cCΕӾYnqU3N@瘌U܊vt\-HoZPqWЧl8‡PlݨqV 1**7W# x`;SDdCwPs! ʛrS(YWnMO}U;ʥI|G9PNA*d%mQT^[x0n:b8aBhDUr)댡늫R]u%vTnMz][q@K|/=LvSLc<m*Jehj1VZƍϾ*T\4g)w늶߰e늯Q ][ =C{nJiNǖSCEXwZu*hzf^/ߧ(|F*TU!M1Uޛ;t*P suqr=3t[;n3r*✍> ƃߦ*@Z6cV_n\A_cQTQOS#8h-Y|?Pn֌WU!~ivLh<ۏ U[ϻQ_bu8$r ws*k\Up%RWju_AZ6 (d mڡO)CQ0':LF;fث|@4je⫔vј~ W\i)qU ^U}chZ#2銬)ӶlU)l(P*}^8qUMW&C*J&W7uUAPwqf [)*qq|1UU⹕wtzqE vߖ,}@̴cp:7b+㔬ScU$'۾[;Eelj((wT;UM;cv銷׏o6͊YSWqECzW;떳SfVKc̖lP+66Ɨd튪,IP؊jqV#Ĉ<1Uz?1DqP}w<@霋rt2MOv/NN~|^H4BrĎqۺvcvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tu,XNGO.V_֗X.G%~_I8JW~Y5|pZ1BM5J6w%T)1=8mx`~=zw<RQfDA `>P&JH6c =*exB#n5c"*Y-=udo (qVAϒ(zcW|UVPTbV*Yը?f j9&/o#*GO>˅S/ yP0 Gsr*G1VB 9׊\TSŏzxEهf̿<ψH&Ƞ>qA;RfAT?cf$lUc!Os%[t⫥*וGpA=;U-nHYqI`p:Q*GH=>x*>Q0;6?ơې^ZG!yO;}8T9uqU|e:5*)n"BăkOA$TP*I\0w4q{b]F]F/}87mєbsΑ)-jM1TVr-ci8Z/uv,Gj~Fccˋ}2wջ}--eV`8;yɪl]0M"1$;oa/O'UWESAJcfCh=}*FS%b$$oZWOx܅"k(Gs)V{>VIIžcWJ|=H?ޖKbvHsy S/~$i XhhUVد mإO>Sу2^H$K>֣j"# "jOۯOܣvn?VTel (^## KmjE(ż"ue(7W|ej+_$STnX:Ӂ:a |ӷN1^T~؍1i@mc lJ5).<*QN^#LB*xewnPb՗dLM.'đF5c{>]Wb@cPV=灚 (Jn+ r+Ũ7ɊC][S׶m1!O]铈qWR(s>@mĐYN&S$8*|bRUY9( 1PqAf+MVJqU)4,qU0vƕzb%( |C*߉?vq:bwǭXoCDMCN_p&x*떧ޘkFPv<0a}$f3n;@P  >!%9LWG!&+Nu;xebn˵N(_iAWڙl4;9wxL 'T4Cl)Ey*LBNY44UawtQ<<9\t8i۷qTT8T? xuTtS(UQE7ib#|Pҭh1UB;xV*#wIkq@fV7C*ew錭6=1UoNفmHiч\iהuAƛUt`9䀏1UPWeV:Tٸq2~˧\US? rnsᙪ7Z%z凨|Ua*Oٮ9[*$T!y*m]80Uh*uzebb_QZF+RUTu1ƂSwo ^}qU/qĤ8.+(n1UnQN[oFSQKG"q^:7qVRoM4,lqUxc{يG7/> w8LI*2q8"9O|pLUIАkĞN^*:Hhe|qUn=m1UZ oC[,MvwW 9`V4`kWlU~^ت{cN ),ٰ*KZUbqT(%z?⪅A |-`69/lU^hlUL6`H>u튬QJ9 VľF`SOw\(VٔmSD2J>URoJ\uP8ҽ⪫0m}\UQS|QZ1T,Jb&FAU[?zv=3@?? /=ؾ9:q{(.O=wNsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t|IZ84rgi}@b(]rlo'@ď ԣ} v$58&#`v8*9Cqb?gl P^*bI+SLȼMgnw2 i6HqCP-N;:\UO@hWfE)]VKsN ҇nmN1Br1 Q+Ձ}ZW(SR`Fe'`z+ZRoqMGӀ\4'ֵ¬K %)51F\Iv4yK˗:j lYBa[CAt]lq˅ǥܽ˺+0=Fgyҭ@B$&_;0Fg=G!@]m l*X|?e#E<~uu"`qŽ9pGҏrV˯ QiLogo$BEJ^+ˡO;A\ǫ&E8olI]5vgҪT zWkϨ,*~Com  Iܐd}1wA%.cnIogOT)c]j $[\ ! +LՑ覠H+V18Aeo}I8da3.G ,Q+I تv v1{wB[ivRj{P B'>CMiMSrF\-jmY@瓪u5RYk #S2O7C~Ii96#aj*c,YdRLg %uqPmܜs SQ2J+1!b35XSoiB4킴)iHXS<l1 %< A&z/#zގLt|5Fbiw(&gI#2K1RKJU[H^YOzԀ bAC˶c((wb̌@8~׎9m_qWbdA>UWbiw"bR=g w6Z[`u " V2wAd.յl! qQ 26@k̍>#rNhȯ'/9.neW4 m_3ł1)%Eœkt?FWWAs"e_:{fkY=x_k^`i[˖&*NLo0E6IFaN-̾O˜J޽aJW+fsāeQ`6U4*!<`ǃ\UA]8qUB=\UBKrmCʢAvTqU̟(TV~COj mberVNs2+upKnψ[ N cu_R:W}UWwLJQx6WqզwY]+銯6j׮`)h5*zY ~xt*j/*fc*h2[#v˯s"6*mISkqI׶RoLUTxPmŚ}ZTby<[4Uxz0nM60Lj7qVf6\C֣|*}_1W|UP~8UjTwЌ*)߰Ƃ:7\U{*:+lUl,mcr{U "# jF߯\w=1UaMC7f˾*GʣǨZ늠.,žKxf+ZqTRd9\GLUSglLF**E;ZN&Hƚgz@bsxoUUx1Q@*a\Ur;u;fW|UkƇј-7^۾]hk)J1T!*\QO3{bHcQNRxU}_Վ0*seid)0{fbqV*db0">* "4=T8%}coT\$%7^Jh0ۮ*Yf4qc[S8ng=QH~1T,`85c ت"+u_]6[_G2Ze⪁ jon1$ـ[vOWtrң늪U\⠍i+bL.)E6隤*C2z`U)ĵdx6['vlqߦ*kQChqWTEJW銩SքһbRf**@ƲvUwQ7]*TQO5rs7X~%O}qTDw잿qՠ;U4tbkbB#2$G,㣊1UWe`*aePPT] Ўa0lpi47\UUezGLg:u銫A:8w~*VPU#P!Tx8* *N,1A%zPolUݰ*xD~!ɿ?Ɵef_t_8~Т#t6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t{Q؏swG˕[Yti\۪2R$Hw u#bM8*;8%dw~|1Uk(QFP>C+ U P:R똿˯[H`dk҇Y(6*ܴ&v#eU֕4BiS֣!)A*IZSD8Ki(8+TLqI PZ{`+c>©~iJAT v>XR3 Lz-JTbycG˗Q\HA6OU*7SPY vqbCQg$WX^(98VZcԓG=qTjIo'% z-6&=uZi!y,#ѶS^dnGXQvU栦O2 m]ՈĈZ}Oa [[ED=qiJ 3G9eWRXUJ~LHH / T1A_唈>h d0zAOcz&;!~̂d$jz5DY<:H\ l*B @+h@Gq\u!Ec4QlɆ=5N`%=9ryq=.*ѝ z)g27$ŕ}lOv2Qs _lcqΧHѧI4kFZUi FSMe phteCD6]+2 +XDjOmYY$E4?>"jH@8xvSSP!ʨ2_9MJᘟHǵ0Ҿ5ee*Ԩ$S85+$ODj+B<0bJW~H?k*v#>f2l.NqN=:b"(`ܗ;m,eW~けD[FG 3΍] r i+Vh!Sj^\T4䳥v_< 9JC1f'oᢥ_dEzŴ< ߶gˢ3[60vn#qI/ُmv!y:u9uA4UH (i]˞cNN,*=kR648TDMNq@ʏ8A*oO RR&TL n9V;m;̇s|+t)03K1B?i Z0 X Mj"go/ 45T |kU@T-ف)lM1W:|-|Ah**ڜ~,4Y kʄ~Q]mSVR@)PEvCWX2Gb S?iNk`PwW@5BbyA;|(ێIU̢+`65XQ;km$P|O\TZdኦ Lfg9sBR%ܞI'c,*1*;(=6zHhMJ kxbjV!1@̌s_|1`y+"#ˈ٬쁽GSx۪\h^dۭ)GBs&*lo&.)/l*Щ%*BHJlz 0ODN$kኢӒrLUk SF5Wm$1UC 1U51xݏ-QS9Do utWqNH*SE)LUx*É3{>8b> []G߲p^,lUjnj=VpWRez7\MbD#qqT;FluiȮ*PӶQ⪈9 lU;W|;Uz|URVzܱWz40[hv̻o|s\v?*mloN\pPsU&rn zeUr1\U<|u %Fq7`T4*;W =6ANZ7*,cxj}$A(AnPvRE1UU$#RhyCS@ad uZC*z?:i5b]w$t3Id'`T©L/ G'cTn-νǂLUEbyeolUo1ʟVӦ*""7m1U)HO*rGĻ+1VJq8*z?eU'|U}q^nJCmb#s@ùcsJUql9sQC֝`v*{z~x`VNt=qxuªѸnʥ>^z&ǭ2w_W*R5Q_ Uz#2z?Bw#犷p~VP|#+\UI_Oc ^qV+C=aQCev qUѰ.*frlUl~ʮ-9zx动`Iڿ,OC`v'jr۶)h0T _ Uo 9Pqካ:7[[J;xUNGG|ڍױ[9rTxUot[m4sNVY$7d8zrW+N ӅW|BrqU[y&;VGO|%z1U~G^H^]*lYoZEDU'S q" :⨨K~'|*v2ԕ;`U9Qe#hʀ, bd2ۭF* ʇ銭1|<2Vδ *%B:*qUXn (TmU+Н=fi*ue#|UR)AsPprOJp{fQ +mYB6;UtTaǷ-T튠.#!IjwVJIm Ff`vU*zvƺbqF*Pv7努}aPuJQ&}rjlqV M7PCt٫߿R/U4:e#TIAᎍ銬ooӜ=<2MOv/NN~|^d4X$sfӲثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tlブ #7~6dzS qِҖnc0*׏Ȧ͸Sߞ'<۶*wn%S+{|IDH9l{v㊯OwzL *1ө Pz x ~_*tTQm*Rr'Tn-ZqV,Ĩ,?֨mmdhȭ ZxaT[׳}9,D-vTv[xQbwhA}?il.&C{dEub;n7j(h~qQ,גv؎}/z.@ Jj)G>4*hP&G.[)$Ÿo;v튡ەjGoQ6W _זޘlPTӕCjï|U6R~m%U PSIؑ„s+Ɗن#c1uŹM`7X՜B&f vaClS>\fޒ]߶j5}14w/@yIW[i.OO q$j|%?4mW.1SqP[[ryQ%@$-wzFE?,5f(/uj :$7j|_ vKEnRV7Q^Awìs [)p (7Pz1:Jl IU)F$8LUĤ<JZ U.C"'ćwa"7J*wT.iRv?4_ 1V?OE*.1GlV$`өu=ڙ n1hHWb7˞<0?GAś5eiui efZtcv6FUoUh'^*=C )qV2Ʋ7ӭVX2r! ʖBH*xYlCϟd$^?GFHNկ+׮X%B#,{x+Al1HNч%[o* H8Mc*Z;behCFuj)`ALdЍyQB#o%_iJ/AMP,QX9E51 2E,7ߖX;fU.rTPםJ'`bwbIEDWwPm^ɥX\[(N A5;OB|֥cq JH)^_gy9>\YD P Bj$`j;Ɂcs5QHʊnR%&`(z)9ioy8sV|LHZ(X׏qǐW94r/Vmʞ1[)-=0 =  T0F,\X e2$17%Tչi]{  d`_J4y@Ӯ 8xO ʹ1Bviy9"J5?k]دqژxf$Rۈ}ۡ;%-ujn9re05y#OC΅`E[Z䥓1F?n 9nN(>qT+VcZ:Gt@{n@Ġ4DžPNG(\Uzܐ91WWcN+D,( B1ޠ=zFШwS'bIt\dxn1Uhn1OzSSdZ-OqQ*`UMGnG~Sqcs4?,QqU A4\p[Ll7CcLU{PWc:Ot9DSqVlDrWp(m* #qYӶ`1Vn኶@^FU1UF@Z2U]ӯLUT|^9^UpZ?*Z Wqm)_qb.{n8⠊vTVSΧ4Fj:b^,(IAY!< ` =܉*똏ib{w+\񰣡LW*pnDrنUEoK㉾#Q&pӥq% 1UnH? Rr b* "b;QHƩm_YZ b=? xjUE2a\Uo"1-qTREsS[Q>f^qW4| u'產⫤9\+ӧ*K)T}_42??1@6P{sOOZͷ\U58~NjmLr UNW)OLTvֿYz(yP©IÒV#*g `Ji>8RsAZW(Upw5QGñP*gUqJe*Tac^=:b\ց_|eqUVQc$^;tWB7\TPW>c#_#2` ;nTm:⃥qT;1 TmVZ5LԨ#w2Uu^S9V6 Tf1WuRA*p34@11Vd<_xOo^є(\U n ڧ45NUU((0pv82|H+1U(zӎ"QJЌmn7WsG۸8QZUr׿1D69~zMU j{/7Ug\qŇ|9|C*LorϣX+04bM/$sӲثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t|3F 9?qܹYZ_{Z##29S2[(d]q&: U>8>T *ZGbvJtQ"bpvP3i⠪##p!,#ZoЏq>تQEinF'T?PvA"0GT?b[T+6>'\UO1T,&&kk3P]CQhG+Zte@c;2*1UHŸ, $.UUE/Y=Ƕ(%]PpE%xRF;|1J6[90P+ lFIYFv$A$-[s1!R?SMjƘN ~ fuרa`ƔkF_#B^~{ֵabGde} V2Y = UbWmLB+4-#qP+ F-α*t,nor#s QNN\.1I|28eO][mbai`,*U?9@}cEw}%w[1DMG H_dEn:Z.adkâw\1}pd&-q_Oߖ@-U|z֊ *2|gzm鎚t Ipr%i޲X#֠o gJlpv$ή}K}`(b 7SJGV٫Zu KHG~2z,MA;KL[$t$~Q3-oA}(cSRGǯO:US%< bѪ= QӒ-J]R:piOяCP1 W0!L`Z1*lm†eK4~^8X:bۏ\LsG4Qd`T.mjkuH ֖*+O&Z^Jy҄(_h:#3ŦʏT=kahI𖯇.s.p)$VQc6xB1 Y~6Jp i%݇Wܶȸ 1KYHܔ) ^5%7XA%bv){xdقar>_'XmU)䑷yfO6]v\}/"y as˻Ɛ 7>p:YMNL|.5vF"h]r@b/և f!W"h^Ws4gӮ0F iT^! B*»x r!*lkac? ǾJAR`H7LZ+{r\]8TӇ}{%^Sq⊴u\`Kt _ yݝ%kΏ,OJ 5n`#ъXy3WY 5".#yn NєpA銨)Mت!G5lq͊k׵s1LU )|Uemi Q9A늴?j튫Ȋ;br2 A/]rWz j1:q8 7Vn=KTSJn1U~0*?AǃLUArOL}F*P#lUr*ee,)vPULlXt=W|U)Q3.rm^ѶͷlWYϏ^W܁Jb-*^XM1Ue;xt;W~-ϏqWWo3Pl*٪S9a)+O?-)bIpmX$bU= ]*Ћ.Ƙ𪨸#0^pqV{cFGlP⭵zc1U6F]=1T4UٻcTᩰ>8ʎUuV0~!|~!0: Z9AJ掂7j0!U53U!AR 1U N U TN(VZF&C* 늪,quUC|K7W^{eǯ*q5QPˍbwIu1dnXxL{S?ۙ[+6늩3]8؀R@ݳPt\W|iUU _LUaLqbh تs)؊:erz6$"5pK GczЊ i^\*zbQ7m$aRQC0^GL2Tw8 §s_b%)ڠYi.c{̥Z©Մ,|MS)W qe$qTʪ*oRd5;U$*hkLDm*c Aǖ[1Dcf$K8=1UVKFMw\r?lUdБS@"#Tm5j 1UI8ȵ3>*Mʠ\ƻy2:o[vmƘ~Tۮ=Wn?&C%8k4֫^(߳aTeQ;T"(cR>lUsO$;8;|U41_8C0VڧctQ<ѱU*9GTtxzubF{uȦ*cR7 =rϳX? 7=ؾ9:q{pb#6Ν]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tu#yqPC #i]n9 v8-ys U1K6@z'E⨋(VAT?SE~u8^WҟIYBd;e=A`UƷG:~+ vqKdpC% pB0*W:.PJzSwBj.p?jlGAX&*:yC%򿒯5Ŭj5ٝk˟0]m^:94N e :6`ESːo;hD'Utj|M6]$R[<ܼ֗q$uVٯ!w3 "|j:B U1Ӡg2쫸j5㛐)ȳ%_oHv酊I41ZM p *oJcZ iRFY~8n]G\ *x;4.WơdI(=i$ *:JԑyǔS]%Wqc{i.\OE 1BJ(xI#Ǔ*Z}3L 2vzm8"ʬ0:HC ToZPcX05ALh%1=1[h#+m5H[#ZhPA5pFNB&__Y.к܊}:uuJ9:Z:1-#&N.ݰ@H ~Ӆ9Yth#Pȣ}-kҡ=B%zn zdI؊SrW'cSL ]FYTU4<\EFzM=T^ЀIKkZ޵]ȫSŒҵ|+d_+yqaչ<SjSŴ~oFt&ɥEbPj@ vT{idڧ =@( (k.IDUDҀmϟk*ԍ̮+R~"6->HP\5ԅ m`2v.$0"!G?q['V|T ĝ+ejPzK WAPߗ^ 0__ՠXQHԁJYeYu w5g8ծ}F2v ޹i6qt0U2|9dsL%[E h:FuI)*Z"v@~ ;oU3hzFZv޹~W PRO!_×7&8דl7șd#h,MOst0@(?hQzAW$J v{dO Z}Yɪ%̎BNAA;|0IY%@=-m]8ь Ҫ>! Oڡ\bL C40fH͈ЩzmHXui-xFMbF59&*QqN|7h87T@&AWppr⫀7w\|GqVW?`'zت3)O^WcbrFtLJaRL~X)i 'cQ}8Tb+R,|[V(~Uk-Ezc vmu}F*H9q;c*ÐX>8J߾b+m׮*DzNJwTې^q;U|Sl2GwتR_l)+צq)p*;qU0/*G*t # cbzUD*HOqHA(M;ޝn )qaU튪:z $F=L*Gpp\m\UeF2GSSت Q5* bu.|Uteu2Sqd6*Jq늪#:Q8Ҹbw8PxǦ*_CCMצ*c劷J BlPԧS31LUȡi)[z|⮗+WS XiSPbDG^VZ~81UB`y#uኦv:G6L1 aT|jՇo0EAJڻeU*Z6[P^Ƕ;a*m9mF!vA뉞KQN-X9۶*HK?/w\#zPw)d1^R=?? 7=ؾ9:q{rѣ4#6Νf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tyt#?ԏ+?/Kx~jLdTnd4!YC: 늫PT$UxǍGlUiIdz) \v&WBQT+-*aF(]"7OooqJOD73_(_o'=eH;~> XMt8 ePVQ' 8Qu跢1-PlTSSNk)X؎ KX7aO mRF H'Q_ 7B\STa#'OuϘ.L+c ,CE¶"P/9|{xiX?ϦszLGU[Zz~.%z풭J3$4M٨ضGRkhZ S4?k͡v=J@A͵AYpےA>h_Ԣ.ߵ+w>7խ#)-× b"3LQmI I[]y=#%F@Lc~DnksayNȖ%E>.\^zSAsdYb ?I:o&`ڊ Bz_!W+5ڼ6B4[&"R$9>Uhu5U*&"~xi ROO*I#\ܢ+H(YdZ֦K1%KK *u7"WژJ* Pt<+慒1T;u#F,z`%W(e!gh#܆? g;hE:| cȞXG!G鑑r`)1 's "HÂ)QCG@ Rqۓm,7#5lktrUMe!7n-[5=>c YOޣ=đ[u;dyJ-UI)nbPH朶4뫁'SZ?F\Cڍf5')RA9%O6Ir-[TbX taV7|4T݁RJԏKƕ\~R8d #K@`ԭf1)M|r)p`TI׶(_K ;%+U^mat_FG#sYÍus4=;:URZ9>VV])mIXH=6Qc$hkۮJ3_LJ|K:Nkx5l8Va]M/3FI-҇!5ӼAQBR!)~mv>vf SçK5YF~Yr SA+H]A?PekGRIe~u!t* 25kɾf8;P_lDprn:__P$b ԭX~e=R zmjVԮ @}gop5ݬ*>HFӉ9\LtBԻY[HD~>`?%2oƦ?r\Vi Am+Jǐ-AȞLC-@u~-^o+fU8mJu8 C7v*hc c|UCP1msĵvc* !` U銯hEs Z0lj1U-(WڊzcJUVU}X?v*"qT>ߡVZ⭀z5qVbdT @QUP;[Sbyeҽ1U>d| *Tt\UIҙL)6c£lU] VlUs!Q\ lk.⪱˿q*Pڬi >+v⭀l7#QU[‡91U),QlOڸq8a21䃊d'3B{tW-c+^*@fqU*0?˔N*H1VCQ(U* 8db;u'j7Vq#Z|=;⨘_k )T`=9EMjq562rW( wP΅joTU\LQuaG<=ت ﱮOr4֢^,9lOB2*PkAGf<{xe6#0X$u銪Qó w"7*QX9*źW=G!ǡP?7t 1ޙO⫡&>u Ӯ[g? =Jw1TYoSf,E|1U64`)vOQe׾*+W6k&Uz~P=b±R7R<=s\MǶX5Vx⫏^#Ͷ*\rLJcH^-׷QJ UoК|J{Nnyu1vT˂f5|pUCbJ`VWټqn68*;SzUɺZXd5?@Rc hxƪq(^Ӊ"cTTL|cLΡ;UuXTm_p,ToUM:u;ت$cV*o5jO-^e58rGQR1U(0$8N[ԭ;q+^XH}lrU9ǁ^㊬b 49T&VERqT⫣lGNK^]!_((Fp*qFUrfZZb}*ؖV;ثdV2n8]UW c U; An:⩅[|/LL;Fw¨+H.u|> >,[튩cq^33sO\U076j>"L]\0P7Io FD']*J2C3:wUj=#JSQ^Sm㜫?? 7=ؾ9:q{7噮)G9m;)͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tW'#)RKԃOQ| OLzP!),f|JPAQv,ε5Ē"ɮDoϭi1T'Xr|Q*wn /(r8p*CPb"#W(G"7?m$J?8˂Ʃ ܂h80،PbהmQq k')LmmƸcpz&h)U Ui?aGwªlg4OJh:|WNFsf~W3+0t͑?LP ݏoX'@Yn3>LH|^:Ǖ|%(ćwgW%cMƥS>~]? #k)X Ÿ6 ߓj4Icq5=^hZ5 *4{9)Pم#5]N ꐱH䧠_86tA,uJC5lb,m[(ufn2A ?gfް"Sd&sc7_p ?eh,t֗RanTRI7u vh#ŸސÃmYƻo:S@03I_GPMG**TZNV'uu l[|2 1&kQ+ > FRU5r*ʼnخhf}rW0dc'v@zn4 8 .I9P*H[E᎖@E7rWhZAuvSS"bUȧmKiPc\uQMm$Tu鏕=: #87Z cHTOl^&ܹ;.GA$j UU6$TU$|-J{@pL7ZڸBhV k'1`8Ȃ)(\1UX+3#5711Xd!%)p*1ۀd߉9 $J P7h"f;W;9% mlҝ63[aERYt#K$[LJ`n 9U UM:[ О˔ `",;R:.. 3P -Nb4XҪhɽ@Xbĸڃ;RCYHDz䫻Wn+)kSGUO_o"XG~lwEVA%|]c`*F D@ݏٮ6WP[h&`գd>~->, jY*MZOҠH 92@ H`s?R0Kk@Q8M?uھlx|9殣a$SX{sQc60ˈc"+}VJ+IU&U5i*S1UVoWSWs9R$LU|j9)=&*-7^Y^F*&ב>튯Oޚ0ۮ*KFH UnQO)Z⮖>CaLUHCFe⭢\ UA88QLuN*s*l*(\UI.-V FۧqSU2G*lqb&M\kTA^ X۶8bA5#s8 F0*VRăQ P犯u'a^٨*"޽2 U1߮CT?=⫚Z0b * T|KLJ⭛|-Ў.FqU 4=wWyZ߾(Rlw* {⫷FoL1#:ث7~ݿiU=qdm9n2^@忿qbp響^;UW @9 UIEX5T'RtZ'fm V䵣mrk\Udq_z#2?xE?`zqT{r>4w; Jv1\Ԛo~تgvoחOZ<_}"5-%\lUm{X*FF=}ت0;>aV;רwjb[$PbxeZzU咇Qx9)[o*,asE{늩R;c0*@hww8nL*:q5V|UwV#lUU"_;ٺbT+* hHֿ2bn:o18Dd}:U~}3q;-}X:?wxɕXsVH">>aT¤VR7~sDiǨ1QPF@ƐzOڦbu rFيbYZU\Uq@gnidjq}'c܃>WB7ޠZ VndbQ5ci*#mZNMVrxl犣t_li~\UQB\or[RozLCE*RڇZ~/ TmFr^*=RÊ:'QqwC‰:ҝ,ٶ*Զ!wԍε銬rASb&:Qq L|域$]k? 7=ؾ9:q{"'g"ͳdٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t##kS+SZ}iB r'-(7#*v&Šݱ8ԃźUrG,b*ъ1 u}UvS zHF89 x-lZ+*%j;[P=#MHb`@Aa,׷A̅dWs$ ; U[z_9[vSbO*eۏ UA{{cPvUeEj?c'Q&cNcױ w@Jєteub9ٸҠYlhzbTDir튫=97n,u+=}T:U$:`-DMpQS>ٟQM>ndͲXEA?n[{|D^rw4`o/yzS SeCw/>$#NΝv+dnH*$J{kBIp#Cj~A_x`UN4qB@Qǰy*'2/7JӒ?ƈ_|O 1+i.-FRX~7s@F4A+%鱀7WT 0SJ&,@ieunc@S|#¤B>ҵ=𭩨r9rX'>9hp-f* . M~݄ Ƞ3ک>^dQ׭T塨˅|#>W3 5 mS2J[B*߮Uɩo|%#6a3w] ܕLLfnۀ+<[!4U cbQ0$ JSlR( 'VeCPob= mr7I\ 1YH mE(v9(yuZF?dEC-8֬~n ۯA|SVuv·`v9jx#vp*2rRա~=&X(iZ^wO)NL| (6I<4b!k_ˏ?BIh.pƔpNIc$1J&5ڵ by}pa$.~:^@#E FaهZ|>#^I(⸘5ܮ3TV<d=ʲ`*SjKU|LMҠ@HRF$,RJ{(tX)V%,0,Oaf1 .N,FfzR|G"W>SxÄPC^Qִ>,CjnO+9<"ZO%/#'oxŦG)PM~Hrb٣, -Q֕~X^~*pIiw܊mvݥu1(:Q;kxf)%n@ǘ⷇ʕ{ǤEbTҴHHj{d;Ycj nYiso2x:e$ɔ'.b6]FSJPoq}LU "=⫤CQ)bY7P+̬F*ԑ T*Mbz6>9uVp!OUuR~aUV@늬F GLURM\qXS0QQx,2,w%jq1lUvWVu)Ufeö*$}5*!۾4zb-6j⪅48080'YV eh1Ut`P(:S(0錭v8W'U9;׶Q|*~1튪)W(@ zl@*9ٟ0TlU\` (LUAC_ UO(7YثEzH\' ,'na(!n68^M6D$鏯CLUH-A?zUf|X☪bfP~WU㑩R"F ت~A$(MG\Uu(GtUsc\bGw9@Sv튮ːQ?Q=kG]"bCZ^#,o*#ЁҽolU7o]x+qUUV"[rS劷T^تF(1UV|U(Te/*c]*Vf#ZY 7"{뙖aW$MץW$?+j5zP,Hֵ8=T0xVEc-wDr(z8fPCQI*⭘ Sw;bhڸ5=p"pq׮*Y? =|16Jb橩̭N1Ul߆,h=T.fB F* 87n|ki184:"g *@*s/1T,>)C]qawm@ݰ**yw)T/,)MUxJ(z,0D@D1/V,Z ~^ L T8/ҎT&닪lU.nW&F*[f"wɩ*T t1P½hF*+V*q5ĝ*SMջx㒿7VOv-U~6*+$|Ic(j6oWImӎ,(N*m -07P䆽U"Ux D-Q(xef_t_8~1Oc6Ν]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t[Q9?qܹYZ_{{uV$o׉ʽd4JTţ`P0d$Ǿ(8>)ǫ8iDYEc=}m^*42G_*w(+` )bR'ٹDB2!>؟q>Wn],QߊnPHTݙ_v۷~bPR-RQ>x+ ӽB{ԩ];&R2Ga8*ҠTÒbd!i,1ʿS:"b]ڿUsg9%e裓xdM4ieRh9+9#IVkB(=IQˆ`=H5QO{Y2w (_۠~:ť}U)! QθÙb)SJ~AV$^"KW( v>HUI?rƏևQC+ll1Ю1ˢӨSOK{ r *tn򜣸iw#E`]ڸW\IrVˉ*zBJWluU- 6lo6BCw=?]:進jq0;0ravT ʇGKoӨʯ߈V'leoՆe$ʷ !(j}r`aէ4j.,;)}ɨhPbB[K'T)ItR;eܘ2@Yj3((3ȪRIWVf]z0Q{bEAx ܼvƢWs#†S:X@BZWzoU)z{ؕYɘzl)Zv "AP7:Jl60Yjbƣ$7U>!t0.ɩ$&2O aٮS;zFInsN S m QSܑ֔ !HAA//4QF_PDh{|=˺bP<*Zl@Jt+a W2+ µG§D!P(2唕cq!DCL\`}lGcf񤆈>3MZrd API"_+^%c)? ;KN|\-GX$%H-ִ9גI$@idqF"bnPījN@ufqٻS劶QK9T|^ uu%Ƅ@Rl=G˱;vZv`C*C GLِn1AߑiBWbbeBgR7XNzg7)ɼ`#[ FpEyr}IcD[) k*]A_Of"9 Gu؎KX$hed*MC(%8k W @"E*u+7M<8¿_-{ՙОn8ȍFEXCqMTֵ`[ lv3?h˓Qm[^cVaOoe&dijX, ԙYe66"BP/# ,շ$CGE8.ѡ(͉Twzt3$ W[+jFcߴ^-y0#᎑b$-V^dLDW-orG΁QC1%lbƇ9W2,Ֆ?0yP/~UfH8 튢!utޙqVxĕ늩kBh:x!تjb8‡-_zbR@ZJ努FEx⪝>p>UMֆT8NJjCV;qC厛b]wٱVEYnYD {es|UKқ*,*RXuqwŪN6RpH,2+maN1UH~8QqeOWǷlڕUٕE1U#F1`k 8S QPO W.늭Pv&TTRʤ 1V 6;{3EDi01%NU4%Je*I'ʪhשi*6Z4+gWTwݎVNI}sFm)'!SR.B:R)Q2lUr+O#rz~M0*4&'һUq;ö]>ثV)桖qXͷeWm A8T}8aC؝cte4ot¨[ӱڸӶ*H>|UJ~@|~xބby*`:+b4}V4^5Nb;:4ʴ YDrtxN;e^0a~Y\=ѷ-QHs#(;eG).&r̴*iz*,&=_OS}''6>P押-.YvQJj0+31ܒI6Q!2 DZD#Qv  P&Vp۔ `Z"l1n$ VEoݹF\Z߾Q>1U@[Ɣ}fvnٕtU-q 1++|p*n{.{v?cY;Jh*Gr@:A;u8 AoS~}c? 7=ؾ9:qz嚅b ӓĎr:vSvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t5K:trgi})*RTt|iRaCNi:Ѫ(qTxnkZu$(G/*P㑁u8є 1 xR=N* b@'𸢸^ U4CjT£ҕw2V"F}8]lUzRԁ@"$~S T\(a qS!|UmcZQ8{t UaPrqtaM=Tf0dk~iM=}88+G+-|>T~ ~3 xXr\/X!mlM:T,pFU9 l fh"9<娬8`OsI}1]_!+DGyEcii_#!LKUVƤ~I^Bdj9(䐩s+ZFD|Va K`&SAO@vMs2Fh2YWZܤ1 [*v'3#NtHR̫Ei$XJs7yO2Gу: >ӸnLeZOѼ_޳;>? }tDh CS͍8ʭFXkԎJaF„W7ߡ-T'wS6z6ƺ*C}*r*XIfC7B*Gя%s, ?Lpiߒ59"8M6>ěVUWooJ+1jxW/(z>F'a[ ~(5 َ>Uq G ?i~TL_~q{s !@mleTo@*SƘX8+=4P NJWc"c$|AXA!:H(kJP~})Z$? t[&a+Yڞ9'o))GQđڀ[ !C&Sҽ6HˈS.+SNd>IF4@$̃ӕjOёP5֑SU܀)˧ÈCrZY4Ѿ[.=6dӔlIB#iJPnOp-(/5$P6,O U+[t]\.T~F@o 9%W0=(H뛀Ȓ7T*{ dyȡX5 7ڸHnl @;{4^FUTUqq*٩`uo?"jE^ A2 وJyOˏyU uDGSb΁giG3#]-b :KH!$ Π A AAKnYbTRYiЌ4 , "vnֲ~!V^<@OcU;9fFۭeW,bRjPV4ȤU;|cTF Rܾ!8ē{ YMHe O6Ⱦ92uPz6m1ݧ.Q'Ke mz1u/71${CS}3OQV_l)CS kLHUn]z~\wHJ*ڇrE :M(l)ָ1,>;tT5e=q;6d>>9RU k B[WxO|X []'8oo|Z? }Y(I~iƄړd+ 8ʛC(۾3Z*%+$51Uڝ2WT3V1Ve+vWK#CZU>%MZqW:qî] I=6c*9;V~ևD1U6B:t+]*~GW#(zW4LƂG^UX 0×LUw֌[?LLت$4mUӦ*pU"1x €xNǦ*=d?ڸ|51T1p$* 1Uwf)]r}8wrC#QӦU;Uq;5qU8^|c)*3F;⫮b R2ψTPcSq]\UVĔju*sˡ?8܃CqU/qָC*ծ5|U].*ǶQt[I !ZciOcux] r=4;bjrrW7AW^DI^~e^=qVP} $rm;e)}UeSA(9uRӯxT;M1UMJ"vOĞF۸¨t8Ď/h;V,PţPeՔ(|;fث;fS㊵"ס_<}iӦP|5b[& UZoT, s/)$P|+S%;?+cڦ8S'maZ;v/ 3B.ĉ*amל.%`U<r'o垝lgdXa`D%5j~ylfVE (JA_|V[)G*0Ƥ"5<k}Y%-I>'&;4IljvAփ&%m' N0H(%~Y4g7T; f㊤JT:.߆n2C^Jӓ]!i ]wޟs\yAvkW+ w]N%,VV4،c#ªC|d mMޘBDٔT֣T ۦ\4&xcU!+0% CU;TU $;WbPDWM[nG@Fpj;w?4eM*dZvLU{GPѼ1=;byccYZ[$u9i+v=xtU[cqTHfJ֪xS߶(jY~8#lU@3Wٗ&lU]P09߮*`'eO\U\0`6ɷMWG:ُ#1?842 S*#]ZBUw!C֝qUB @_["_ՌJ B:rPwVӛ4ٻ`ztvQG#`q'JU eYIN+04bGOGgNsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t\Wb7trgi} >;?x?IĜTs^ҥoJO;c**B#_]4DC!5J\ܝBW,|OZWMU=Q EEGlq54TPj֞<4+T 9bQiMMc$q=;UIUA<1jS"+#bb:b Fs2>XH5lqHkCނHS{b @ө56Zo Ul ֵg{t0*ח?.2ԁ퀌v4 *欆a+k'F~_|DmNXBj5hR3!]s#źɋ?HxtXhU*#+1ʲŖxڒy  ;<t @bM܁T+׾Zp DŽCp\RM|{̔Gڅ˻#ZC'ǹ|ON /GTeԗQ"%|MϻdrF5y.-Vx"Lhzu+[%'I #䦧vWQO L"'{,J[{uu;Rߍs'#3LS&pdEi&H@EI! r=cQSrEqqNjiT-7-J*6V<::d%,%-,X+N)NU?Tс^j ]V:[BiP1%VhIabVEaϸih鄾Fނ3||!~?yG'@5 Wr$|i +E;9jpu錸s㐻eKeuv&hDr"oϨ*W'18q9d ;S:ok,*J1A׶r &˶]I9Tei N$JJ.̠?F(%n>Kp̱+_.UG%i Dw 7@RC7 >+k{wGHVժa=̊>{%8f3(Tl_]cWf~klqLjEkēZVyb5'<$BOq): >Gyz~MO@4.jĄA骃ܳ{$wTh黀+Nz`9h@jg6$Ƌs?U$cjp-B 9I~=-fU!W6n "r6\Ew"YM)2Z;dN Afu|]jE? #etZ1` s 7X0 })}բE+֪¹1м.Heܯ&>D>l+tڅ3QNFHH^9RUf LUqJiT=BvO|cl)U(H5wQ E5Zzmz7 hycnqUPr8wYT9*ۯ 똞ثq5#\z ⫟9S"m8UM.8 ;`ji\^*2Wn@Ueҟ(vTDM+WLpSjB#e:▄y\Trn6.F\yn1U`S12Mv1TP=\ԧAƌMGCbG:aUx8͘=p+fj{cYH8R)%dQkT&4_銩TPr% "B6#flتM$>4w[W!6nz"튪uq4(*琚`qNUclѷsG;1U87ݍ? V@δr APnI`2lUlF~&_9ov/1UHcj*z(:UxUbJ߿( qT3"=!OTV  $ Uaһ0WF,hۡUT"9[(0jS*ch\FHv=8oݞ*"pT08j km/PLUMK(M늪èa1+݅U% :Ө Qjlu6ۦ*mxI]"fC5N4$m .1= ᓠOzMY{TZ!X-N!>Ϸ%@XTrUR\"_ @!-Zȵ#=>9ˌwhP oZZ#X>""T{b]$HC'~MQF6p Gi-T5| sMi43C"A eM6Au۽f\FP$W.3=^l(}n]+R{!dG]QmbWFYdAО)逆ٯxKa⿘y%`թ= d#!=E?ARGʘexv튬olONQ} ~ a=NjCMq? z$1.NdE[`_M?xxVDn xXlNǧK Uс59gbh զ7떔$*1WNUY 1vV_T) FiN00T cG^QB7#cRYE}#U⯵~Ymj*!Fت0状㐠'`Y*Ug_SO|G\UV#v9mQcALUr:7jcU@iL͸9AWPOAcJWs>5iSJvUAc#q ˥zFweC⨈7Ƽz5cpMNC *qQU1 T7 UT~}G? 7=ؾ9:q{W圅X?9slNlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t[=?ԏ+?/Ky7RԻ}8F2|l gACG^ѓqUT/hu̟ zbQ*u!OتY,dX|{tGlxaۡ ,hHoOq[M~yPrV!?[71W}T_c_ݷOclqUNh*x{e ӊDem>y@SqӾ*bG؎`(Ď`n*@XQTŊO1T^ 7Vc@ȓJHD.J$ \-K<& #-gֶ[Ou GFޢd\W˪ [Y'm 됔Eqp"{gj򦎺 I0cv'9-fDai~NjMY}sVw Sf=ſ+Q[[trYpBnQVNrY"8v[]5wAp-?)Gp@)V7ORGTx'x]wZS^~\!xcuF e`o9.KX[ ge;8y5;~hS>:"΀̩~"> e߁BP`YEK0!k2 'H 9q^:: Ƕa#yiH`26RO:ᰫZ#/?pq)_1EvzDCq&)!w|s|,>b )N|H)m_,k"2ВjVx٤_Uy'oʮ$jJBllWjvv냒B刌xVc" ! ^Dj|1MP;|LB)wDGZ$`d5jk@R"B  {suUTjgUƌ|KV28B.s,JP=eh7+" s\{ٔyjG2$u$sn dH#I;rE-KK_^fVW; kvҤG$?OCOu,FEHqOUz\?/~̏F$ _ ȱʠ >(f'5w/C$O_ fC\-NNe b TEfUUle _jˆv\ £0zCE"?ѕjqO}$ɜ@Nj ш:zd Ɋ~@z{+\ƄTlBA=HA{k,O\bTeG2 V9̲nbf1dC ᒥSi SlVP=1OF* ^Ew`Y@Nj*7vP85hp˖|0`j,:lp TP$q8E4 tJ"~۽5j ~ ͊|cuq=-#[$~C*)\*Y+Nö*֣5UXuFƕ|M:z8 xzzUU%O$P{ 銯fYcNC21XUOQ}3WoUQN\o lUC]+*~WU uZu\ReqF*`rɮ*G ]*TB2W^%mqy" ӱ錑z⨛H䓦H`S)cF0hKSzc'Qn} 6I4G1_ Uzf銴Ȧf51W!Wm⪑)N&E N*NU<_?QbaOFPV *olc튯RJ'BQ ?dq.n;`TN{CXTnJ늭Uic9`m\Uc Zӏnb }z;bнvc늩 3@iOMU5*r$WlVx:lUltۖ#mC]4@7%>9WSGçSoJD$OslUmPx1DpF*s 3m6\}U銡1Ƥ㛎*ِ\lUҴ9*mhE\3o] פDž@;zDn*.ՍPE|U ^({bMTT7(F.xQeЮZH;P0ZDm,9 **O~*U5#4ā|x[xLt u:Ey>Af\pg9IVDg ,5u9‹OOE1ɍ~?nxn y|pl9[M[Z?k9ΠfтUvq̒zϥhM0 I!؜5յP[Q(gjw$R#2I@@w߰"H; YGZ.>'Lǯ&2'vrُ\0Yx`%RzucwPtDҔL:m7&ؒw.:;:fȥEC#Wڍa2[1:SVz<1{)Yܠ,l<Jdv k DnV8C&^|"a2 RX2w׫(`@Z5r)#<ӾŨ۫5OUS_Uv yt7 xFXna$Q:@UfX5\%K<eEsye6rSԍWT㖄zD^i:cUM0ȼt'jUlayQ 6zeqО2 WR`P j@'fI;0HSF>>1WKCP;z"C6~< VbW<2_JҜHq'MQ\TSc|`:bǎݘW|p~늩!ho]1۾*8дb7qL{8M1Ue;7aኸJF8U2/ TX+x 16ˑ*+`UКʋqM*ŨiЏzָyw͹wzt[bD~cAVLԈO\l\UVC7qnE:uj!yUM7jpMEv?W!>d_Bީw=mF^!AYȒr:? ˕K#,Rѯ[{szDY24OIK?Mu?$y@h^LVI_95g(רAR݇0c׬B30ܞ~Y5c{WWfKK$jtXVTPP4SSIjL kmɡ1$="qr{1i#K77VN ԃS8_jPi޵#uYn &TLjR3B@k95[۩Fi GSڴ;rCsݓ[UQ¾ !ه:;|Pݤl#+) J6]Շ#mЦvx>1Esgq dtvqCʋ%TPO19#+{^z*-TS1Pʷ_cWHA^k)HEB7|zmQؕ۸%w&QQt^׿J=?@kŷ\E )U?Ī (zЂ8:n q"5فޘPl[F$zT>xifT2˸KZn#MƊ|M)2wX"D=Er2\XǏzSM$E ~/JD u&aiRԖjߴ%닚dPVp5(KY==ַNQMG_rɥyS'ċB=/4E,9Nc[b:&^u 7΁2}v*Uwhڏዲci|e Vu2o,F8T0jq0{I[+I1 -(piʂے.Fb ـ;r+F-S`FKğ1jו}`2[I!+ pע3rgLdWmrDn2%X"Hnx?v9ή"Ba\pp\ F@E ;E ?7pQO_Ie*Q,EYq! #J7jN{P`%  bw'V 9FwֆC]l|3(Yl@6FM'G2aJSvRK o j7 Ԝ DsgF1I!_]n?Ns:QHKDŽ@ '(dݔؚǾjEĐy;V-+)Bz%*ªRF.@ ?NTcx|_5 VjPJbqȱذT!uy"(b /P[/iGC^^Y-$̥*??3,!6Mn#,kI+s$38S9qgD(Ѭy*OIfU߽֕rmIFI{br (]q*4kk3*1AnxԐH#r+'SVM O)yqKu^\Z # Uv47((>#4+]r[TB)-G rHaQy>(śNإ u"ƣ6FL"d#i; _ s:1M9=@M;3ч ;fAc Ph)׮aTJ e'cǯ,?0/#ƭN#L~vHeȼTteQñf%~(v,Jbw4 g +JW3K01_Aѕf$)x'sr*땊 "iTGCd=UHFؑNLqUK1#cV7ƻFU)^2mצ*WzV]/* }qV.br*W̭֞nH=jMGLUWٲ1Ujh@]kT'qUe(Z/>%Za{Ul%Wsnv튫]ط :bnP3@6̍F9&?0@zmcOTDҫ$.ƝU)>5hT}]rMN1?ߍ늪4⪈ԕxxcI銭˯lrRxǽq͸TcX+LUvw~)E GLU$ O_R;`T? ˿lkuªNW|UbWĩLU5h~MIrU܉'-O|U&d2) *M:n%w3~|"o{}ru˖V(j9>r,:vMvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t| 7N ?qܹYZ_{ŵ'dd#e{JJQ̮o4EuR*DOPqZc{^eZKl*AjtALd*˒J˘m`Ycԑ$ķmv6by|t8ocQ;Z_SMibTV m|-'#HvxJ҂ԖTĩ'|+R~+/!![Tג|kPЊCJ[jIJN]ۓ'\1bJV--b]xa3H^GzP@j(!@+G$QyN[XbxZo\8 ňe۝Hn@P8BT_l]O}8'%VmV[%uaӸ8-89PmB|ױi#1۷Z S`UIƤ66F(\cf0Fn(jwY$Q¾=) ,jG^Ud7F4oN٦S pmYB@[ޙhTaWn|${+պt⮂iA$TRʤ]-Rx)*e䠚z7Sp .ه{g55$ԸYlna~oSEtaE(Yq+FTFj@ncQhGtC Q\ב_:SKS>_ڃ VԌZ5؂)!> TW8XNwI@wB!m):_P58llI$MJATZ"f;0J1EC+LoBOLR4fj3VvȒ49 m7ģ@juzDe"\Ӯt}3ܫpSJ(i_G9)Dv"^eibc O 6܁eB$RMo\" c^ F68p]JO_,shn݊~i1Rm4ģ\4Ek :iޑ͍i?\K&1RZ{MX %!lJlB|m+X[ Or6?9^a\EחMEw4J7"vQzfYGZ,5X|w69"q(;Ke1'j1QuژD0=4OnԸ up 5@qnW"zWR+ZqUx#ZibU'G*QϤUH#Tt;\Vo WazC)Ae+3s/AYq Ncm*mQuWiŷː~*#$v828DS|33mpa~A`rl7ۏጠaV*Slj:MhqU+E{w=k|/ b6'2)mv-:v#bPH *(Iw3)R9#? &M qTPRS4S_*"*>>53 :⫣w=<{cJo\UR9{Hq?ND˹kES Gy3:׾\2~Y{f3@Ir,XjױP.G-zSF*S|UT-d]*[ZҦS2dIqiU.UZ>_LD[S,UJA >\;U_`햓P]5%nm-*;JA߱r+\щ R|=_*$u튩TҌ(98r\>8!?mrJsz]Y<ڼXHI|0c!z8ʃb@$WIE,БSZm՜vk%AhJ`FfOďGğ>`͗J^O r{I$l2YVZ]Zo@hk62ю6[V˚)V^HB)j}s@:gXX'0& %cSl 6Xm$~ >'l+tVGȒ-aaZM$vAnܓ@RA}=uuEU@z}cPtГ2d@AsvbY9"TR /5~֒b9?Ia!^ZN qg=M=36gwEPxZU4؁!ҧ"#Ju~sp7FDOc$pG^\uzE--؍y(2{WD^UDw?w TIpCLV{6\|n8JL-PPkϯM_Axh YxM<γ|5(X$,>Ԁ"Ǹ)1D88$d,g,x4}mYo*Qו},-?UQ; !d+yve .vMm\@3 ub贞=9-nU N;ջ5TVS^ƪ w9e#ӶZ~x"}2uV$3Nc5l\(`;oӹO\UksQ6WlUU SO UWԠ':bI_pE}rTs̬݋/~V(] 6t6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?td?ԏ+?/Kx3Y8/iC@;/*IG*c׶*3Ze/~Ucr,GchqUn2U*S\rۧTef2-~-êqbkZb1l BVf> o1W+U*D_riSlk\Uk5Y~"*A:kˠZ0;Aާ#jyoRwHMYu{\ޑ-N2·b*8Z"G#-ZD_`)Ŧ\\pA[C@g1:Co|^Tz9:JEӜTsl?vp?/iM I5wfY.1ym)ąV6 Wz~ݰYNloS.TWꗯɤPv A\ `eõ2_ p92_eIk(XHۂbm!udfNr]ZhoTAX ,:9h 8lNkU-n!+qYĝ'#ίAQ\ۇQQ @R V5.tˈB :퇘COUn]1Z"T Ϧ*e~XJ1c# vǙׇSos(S>D?F'$joCz;.Қ׾6!YU*BWu17RG\ ڷ1QҸ֑uNF W ) 0"Q^"ƕqb Cr c-ѱ,GUndmbc*z| ` X#5MޘsSUQIJ^-YTfaB݄4bCv-eKŁ(ԮT7vlgn[' hGPGB=朌M;,a*֔= `kMNmV- 7K*4v5vS,V*,T2*4!ǶẌW]HImBpUCӅE8>w'E|E'ڡ@{l#`|*jyeh&ص交-Ym'ϽA;rf HPx풪  [+MfYFK KBjZ[McQM#K_%10+USNM͑gTvuJTR:0[TN`[?˜]gc3Ӓ(3>闗|o9TSr9n#Zlv`Y$x=18 {RAbPrݏ2Sxby_ጸBwd2A;}[GmPTbr|) )}$(}MC/Po ҮŻHR F7.+:46^Ɓz+x>hEEϰ_l[?Q>ks˾8U$Tvlys~%-W^eGLDfc/\7.l8.ID'W4RzTvj'@7>f%> B̎MVmq3.^ +[ҲCNT#'9ԉݛ7lO6IiTI, . ᗃMDG)x8=]BSlPlM rfB( 7|vmXҍ:ig4)6H_} +zj'uX+uXA#IT  J{S Uzc# Gmɫ|@vb~2գjaW7>5TÖefT-wA':DLcs9j5g!xB_52*3_j 2Abۯ7r\}Yjv \N ,e5v6=jYW*}SH'UQC=I%Xu? 2' C);Tb eBUc%jqUrHfN<3ɰk6-ZG83`ß/89^ IVH )^|iBC7u})dL$5eV@dwblN`KPޟpےMG 0ƸȌCtƐ= eSm\PZ+qi8¿,i~*0R6cTPT2 F1=T]7*m?je֣lUoSdLkW8,k£ * :fd 0ĿH”TnpQi[1U{i9))Ҕ0ĸMƱb1TnJ{P<1!K(rT {[yzTz_{97T͇j\`5۾*'PPLukV J׶*0GǩP(:8}ݱk늫F~2Ov8Whiӱ늫A(qb9ۯcsl&_V!i|~XӡuPn K71W*8}sqq´A늪 u8kFV |6>تAǷo,רZ ČkoU#<0kbaǦ,UBZ=8¼NIMQG TYjq=MoCc銫2Z~k3|n#GZVtu2@*~=pFy2B'VZܷ&z˜&;t^=1N AO~dd[j珪Sҭxncsڴ;s_yK#37LnU,mMb+h*o_\p#˷<MaJ݁>̥^a.Y"}%q^@J˹?F< ;XFػD^1} XZ>/Θ/uB*$Uv7:s8${n3Iʎt۫H/v]fF AR:e\BO.(z?l6 y9ٱ\]SӯbPےnJצetO4[b9SQX~i+XdOC) [˦ aC]@Z`1'zQQ;yd̅ҍGD Qj+ʔ+|PcK+]fBA´zaƃ}j.k"~^9,o.ƝrfqS|~`w7$B2S+\al7,ohVڀ^rh7QjA\bB/K;-Hn햭ƣY((Ўr]*;)j6!T1CQkt̄Ѷd5?}`T3#'Qᙣi פ9w } 㘁QBj{VHLf:G*S*܌+mT(rdCec'ӿ|UW+UPj7䦞 n0$cӾmZ*qաTjr[G|⫣?mWQ)8Br*kM|":Y؃e4{U<%M>3̬݋/~Ut('HͳeٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tTjHrrjB2޲6N\n~R|c`1l}UksMN~8&VCF=,P{)U?zWtWAG`A&Qƽ㹓x? 'j?jQV8]Džk+lU-M1qU)Ȣ&܎zت}OZSl)شK4QG9Y6h++o% )Nsn4|s,G1zlpG pBƿ3CD. h:}*ʯlQ@O%y/Tቪ!GNYj}#S5נ5-"ҘfĄ>/rn\,$9;UAS[,vм*6%70::N=*V]$O~*Mx'/e]6G 줂Z+9ddh4jw7kYeJ<30"S akZapǙ?7%~/4Q#ReOG'*I5煮4ECUr~s3y妁b)GpgMp#žtfP1'(I {y GE;m0 )"OrkHذjLT/ldeTPtɆe$$@!1čy4-hF]ܑ4SUG܍C;8qUBvn=:,|FhוhArCt-pTq㋐<Hj#:`J`2s*^3w汵HS"M%w/!NҩCpqE%mC]$]϶>.8pOË6pHmԏly2Oꆌp}񠬀N] $jz, *JRd]v^ğtHY_e e '1ZX>˸=2ܠ`іI:5R#xH!bF_0xixOUQ(w*ڝr_B}2 $fDV"I>/@ . 6mՓjEJX,c\bvvCWoPo|r6U dI$rqUBjt75`PiLCq(q6ǭ:(XF@Lez R\Z6SJ@ ;㒆>0] +'0 8i4mkGjN/9N\I-iFYhֻW:gtD?Q+]{g'1CP-"I8A33ꊿ<'sbP qSupzB/%@ 4peJ7$_jyo冫ecw:lomHXHp@2hhҳL55ȍzE+3$Ŕ[AܟY]\<LU!_;2A@ +P=A^,JROZaU$Ps*85BA:!60Sqh :w" icAMxh Py1~S9Kl1ta;V4[1s@t9\eF""ǸbOJdVfk] ~a3AXrMuf䌭C!O_@XJ#&$dg3B1~(=N+;H[ͨ^Xy%n~Ckz176T^iaxd"<Ҫu|a IP- ^O O.\aY d  R5Ii[r@k1DfWmgZ .ۨ#,$h=$^HVqĪnLRO3~$aƾ8 E+rV%--|zLP|\H]Ҡuɟ<5aª{/\&>^ sr`rΛ8zGOL;"L@w5Yn jouX6-!Q}R37*ck)N7R Gퟋ9+[Cm?>ۻ0\c\pjEPWMe_l-_ިݏpwEW u fI ?Z]_>ٟJry\zA lSn3Uk목_qo4F1N6^6GFVR~\!CerL HqӶ | sa J`i ;5>p>cm| 15yB-ULR@~a L5SfM'1\ SbצEJBrzUP #F*t銪,<9xT1 ݷlNQxB݊ל{V0@wWXo' `\r8S-oF>~V lo)+BFڱ@UY{U2OVW$LE9h@*7=^j{6Koqʞ/LH?04eY)XVI(+-'&פIH~ L Q5>kYRerUCP\r4E+8API(c D{(HDUL^#Gɦ*8 F=zkiYѧgځ{%ά4@n?\q{fI{mC4HӯS7mFC*q p-ӟPt'| ~37WaAݦsǨe OaEcmjmV=BIU䎞~B5"5+_r\بɫ6ò #윚$U w"m?Sh$1HeJ)l &  |`Uʂ֠QS­z,C* B'WQj|$eF*]qb(8ChZAb* $;PAzn<\X8e|U`18plՑ5,i$RΠ5&?˖bk ;֠o*( MSԏYBb]ERqQqJCۊOqZ"ޛjEP85:>iJQJP"klUqAت0 C [B|zzQE\UR9 0Wߦ[xb7r\U ]*(|hɺ>@T՘Bw̵1u3@}?? 7=ؾ9:q{@.O=wN3b͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t\0>'#?ԏ+?/Ky.#0ŏ;mqWfTQJ;Upe42QR!GߥqNJ S5銷Umc|UJY=#i`Q R%xUuWK/R64_PTZ*[kp^"Z<:rYϕ<ԇ 'y^RۭNrJ@Ql6.*+$b+Or1~<sQ Lx+Mw%"*;?nS-Zӻ/\Ŕ9olɦ'?1^ZL2AO5lKNA ~(j(v/2$REO,e}0'sZpiۅePaEb j2L?U~<7xeX+ʱ,YY4P)<**<_ŰO] UkZHrV[ u"&GOm.1'I%p~!K!c1ޒ%vS֗G+8r("C[8 Tmvn_E!z)avut$t'KS(QP#CT'U5q UnBRo Jo UQߦ) -&kñ*aض̠r^8 (7F/-c =cV>q zԡ>~EH8ڕ4|PF $,U2({b[I zr *L ewC(wу_f̬B*HΘG#42sn- :o"4?($o 1H!@^n!850h'RMN`V ssһRi em]4 {0I¨2jS8qF)9*u-'A,*Jf$E4Q yl; $y1l.NXйjmصmAo[ 5l["N~XQS?|D)B2^:@>u`U{<2%-F9M298PM>XU.uImELJVSrqeBv"N}Y 0*H R (MvنV]myӼQ]%W4꽓fgYb ifՕh>#\"hVNL)=3YWmRXdSjwvs]٩0XS"G. ZsPt0| sWM.rPv{䥸~8Z{c6$:Ǜ,""ݘ&?+IA`d Ate2rYnĜy0WoX;1cҵu|^iEXw7+?ǭN*iZudH~Q _%A$gaI> 4ul2$8E%wR#eWO}LGyEבUm%csaRӏ)&,V"hl2{ҠXL+DyrG#~Wc hY~O%Ig]>ܳ|1AE8n\LԴjRؠdh0&] l(:-WQݹ6,^M|Fӭ:L۵ `^U+o fOFf`ΆaNl@r$l_5 C#O B^pWs(*7_yjX%nY8 <es4`7ɍWJ$i&ewgsjQ=Z LR+ҿ,pRvTWig=aLUZ' w;aTH,¿g^*=CPkAሰ)GD~XRa^ثl윰*%^S* ^ӈ\y#QPFАI6ixS\UV9@+_*uH*˷¨ H!_qVmv>L9 ⫣2r*iLEQ(#ӓŢ\UyfqOqft/Njs/!=b F_`jF.p*^v,.*(*;uTTaE㊶Ɣ=AP)HiZQ=2*؏qS~U]1銪A ֞؛/c☚4gnn1Ur"d'~GPTȹI>j~e`ƀ< Le7nPbUZ#7LfAlV R,&_*oKVq;0fl&""Q'tOM98$}O|- 圔Dܻq- =DDͧeR<趥Q~#ōOݒ+*5}Tb<aU{QI$"Sёj~gnQ|LWzuzխdi1G~H#5= ;Д+'29J Ƕ؀T@Azl(åi޽F܊| 3kv7w,(C9]N9yvt>RT6@yETӯ`WQlFcEL%za12(>ԯM0qVA;qq&w&>GI U jEE1hv1T2՗jrت؂E:˯/NCJlz^U Pŵ?g-6'|UNaȑ"{f;U+'*EYRB}1 Tӏ Cu& 7*F'"{cl $cbyJƅUZRAu1V q/Ot+ySa*Лf#W߾jTbzu#iIzdmd Wnf+MS LA]@.ef_t_8~hĎqۺvcvlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t\$xHrrjfS)?9kF{J\呷=|baޙm\Ur+}ASE6`F*ⵠrVұ\ƴۮ*?~&8Q1ޣ}[(7]8OlkKlHYgXs\( w#.jYߗI@Q QIr(A2mQ݄@OʭŊzrsQptjs+Kx=Mú^t^; F{qrb" RBfVcɕ_˕4 )Δj?n\ې7?WǦ9 P/< fvtxÃMxxMtgO?="͋`1o+Rxb UbSI'.!9)B]=qeeGZud54Dd)'nKv 33[fVVLmGo_ſÐ;jZZ35(|Ax!Z>8b9`+ (~njB5 eC-vڽ0p> 'BK AWʥ:"zdoS&+Nqhm)Ǒ[jtl,K,|G5xqS -n]v''~J[úk|jvxc9ù:ґp$R6xtևҋ-+Y.mj?X)LZqK}8[V<|Z‹ω4 2y jy\:׮Fa6 k jn?`R@U;|C2m0deuг;2Jx"T|)V~9ΥKi-S|(+,[Xw=CM]1I14⠍}9u"݊(f5AOz3T?3\PJ4ҔxoRBpڞ! @hO㔗 $ܕz R1F?s ;8?  ȍt/@fӶDH֨NwF[H%sQPMNQ6dT1#qȆjuGL:IU$e"bacFdA;t5\,N/h{}d#(cu_8dI *ݰkGu['.V}_ u46Z~?ɱN*Oޅ 7P>IE"YM3PB sk:$c&j֟Hίc&c%kM*{.qZ}Op 2)**30 q| +{7 fo*XK?ZYSTQ(7=0R۠.ئ X(rw 4ޛdIO&ۨg8t"UZ4x|BnFؐ[㱠 ܂A+rl˕9 7$4VCLl$'SrR9'Bj+PYRwĥwEl#YG Nlo~,BXvE˺ܲ1n>6mǗz\vcG 'C*]~#\ kX]NSkBYe~H7ېK˃Ʋ)+J{fum~g(iN 1cSBOA!܃fo8W0XϨ7eVbph| \;y (~dX+!/a/\~t×n6]նW;ª`>bO.7OpqJ(@:drzTFnxOMUFёCC);t8$+G?b([lPqh ) 0*M(xCM*qV:tVs֕_~ك[dr^<A~U`UHV4,7 D_jpDk捸S?lN6lc,LNIfl6 h-KVU|[s8;ǓO,XԬj7,jw2ƫE^2%h5;.< (ڝ'R vide?ARwO3O /5ZSlgCMbC(^U97_0AN|陀vo/z*2,7k-wѽ,O\1PաDv+AqܰщHn vD#@S 1h՘ljjo+xF,ДMPwSH }XQ U~鐴X7P739jT^@tΓo#jrԿZcY|̯Ȭ[|/Y ڸb1hd$JqdHnEA+!ueht'-$*Z$S#sd4wo nD=۳DquCYv NxaiȱەHk7M4;o0@prHd6L6NLxM~k^vc.#]6z(OT1u /#q\SnA>N[MƬK(νWf(x=*Hٽ+2_ֽ B1Yژ*O7b\Jc!'1_ VFVcda'F5>;6.ceI*+%TCIV[zt2(֢vp$L{HxJ/#̊NHXߩ€}ZW-ÌӠg=>bW'`$],! Fkg蚿Os eŠٮUB~ԊSYD/̞_Ap; [k Bv8ԣTFҭvjkk|ejR^s7)CA7!Yn&{ꪯO@OLjT/Y@IaOD5eg<~φ6y),'?N[A[3PPG? )v"ILSXԑҽ<+!p[㈗9)bM1T% 9) Eڝ{薘!A;R >h¨䥺KHܖlT/G`SPbP8Ed}׏URDfe+f27\ C"dgrQtrz|k$LrNhP19A'ggF?OuricIJ$QWU&$QQ@:1#UCobTߣ%,V3"qcF[SqcI"f܀ t}0M..#(I^qo葬|m$b\ 8ϩrBw(.+.--AT*x[ CO)N@&בMS%i/H͹| QݺZҝ>a>"91ӽ?ɦD''/eőƢ>cŐQQ(\6|D" +Cm֟v3_lw('?OFb˱#UCOcQB&v+) )J5G+Eȋ4*Z~>LпEYw!啔(Uc9fŝ;l1+Lӕ$dNXLBŘiЃ};oH!XF8HOXӽz*}8j˸ر?genH*ƨT~w [Ya t'bwU_:ZGqOm&!doTl-VhVf1Hw5e<"lehx_P ֵuaџIP/0vP=MFv$O Ƹ(*Si`%Ë`!.I(+ LJV(iTJNvQ '9OOd1)0R} ! T r,AȒE UzX4`ۭza) Q{抜W=kv+R)EC1Vzdܨ66[qz|I') 'V=hKGnf.|lfV[֡026+,f'sBǽ C-ESv?͇Z|ugRҡumJEAJ q YF9oeoQh6 k得no'u9$ԝɍ[鱔xdY,h"ɒ55cVaҜp N]ZW}C_V~~syLCƜ|*3Ӧ.)ZwJI`z45`e 7̀\t|![hnͷݻ{)Tbӊy}ojyT!ig=@rU~4iJոԟz ErGR0=Z<$مI]@Ms,i-V/aI璎J_yh$ 7%ZEsƑ*y|ma?c?*C|mb> J7-LUT':Ҕ UXMv";{e;SnثqGɫJ6`0+ J8fS*͟R;)~]!.1!qc+r ,~?T)QJ0qUѶ_+\>J'T6Uevqm,(F*E!xF#m)Fʉ ulïbDFvdp @Ʒ7VzsmT}4 GMʓJ͏+;*zOT/˸')z)(z+`Ȥ ]5m O(tP?Rv#}q 7UX|p`^#YuT 4T{V!Ei4fŸ|lRۀb|ö ݼaR;7C`cnV-hj"Zy|E$?7+jy7;oZEUс̊2]ɢ)@p "'JSȍ9YyvCTQ\2,iIT ل"UNhtPGSv%܃r2pMTZv_P y56 H *weVҩ_a`@Y1x!_S ִ㝧MX~Q߈R(8d6k%rr)/^&졸XNI\MnBUQw?NZā eV-6+bvө_#_\_w!h n>OW y2@ SRNa`; ב2l ?S8P[R~ B(؏=2,+Ǯ KpbNGxkiJE 6jd=r$tRP D T1ĕ/Tp][L ZY6Ru%)Οk:="855e Y0H'!B }t`)ޚYԒ>9R ,C6xZv;T$jWl`4֑rtR '>|Ǿ9d rۅp]G݊~-6=0*{>DG;!UMe1(z|~XR Nۜ U*q%BSbTF:U1/dž'*сzO^Ei*fV;<%O\U HSqPD`EqVq]cSu`q =0քxb 8g eC*Вn1n'k]V&9s̬݋/S h1'HͻfWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tl#7s0=D8s2PĽ+\;kF*օqaoF1#h{b"0䀀:ኩKv;l.n\[!ajRAW=BMV[9XI%:D44>PS-\jO鲏JɿCSbr0_=qQV΃DB(O6mܳ͞YEߑVrciHEQCG/CILN̷R#HXIǾ^w* R 1)##4W4ۭ3}m7^IOjbXRIH'?g%{W jG{-Q8 k@1~M_߳A'c @IT">?4y y1!#lyZx.[ƅdi\(+^kſey͗Dr4nN͝.$`g7#,flŅˑke^as?N/q $d b0KBXL*0Z$ 68kUx&R,-oq1BeEv]$Y_썁E(q z##A^_c,(ۖ|P>j:"0S^-MI\Y4bPOA=q*GLіx~6h v(PFR(K(h9J;n-fř(4ݭ)/fM6ʖGҦt):mInFl^ |?k,&P7":i'񬓊Ld+Zd˺qr TЌZ~o[",z>4LL"쫷>fRm%_j*RPDT7A((4^|LKҿ37%yc_ȣ".=2 Sb.JQ`[hFgޣ<g,5[[cQ^\_i,L˷}NMwBֶ_ W gCD*맨=WŸ5\Gqjk_뤖s#I1ͬq(8DdzA*#QGR7?[|rHjEd_:Fe` v!Ⓠo W]߹1Ӊ>?[~TTh3xJy8uÜ;:Mu*O 9zQH#ր/ep1cMlwV9sW~xir$fa42AUԷ_-4)Hܪ)g5Y}NL(Z|ihdsRsZVY3ߌ>oWp2_sF@7d+;e!ҵEz彗hRܤe),)޿ᐇS_6#Vcѱ`Mr%V'y)|6 o gb?`->DHUI$B@r Ejva7ig5VbVF,;2gFQ)wgY -QZ),:ːŏI;t2 *DJC2!7"wˉrG""+D&(dیM!AA/jo3Q~4ll2YMZ7+LAS3/d搗%M®@Un!Frcet{d$7ً9J" 5Nc( 8M̴?o~$|=qqP4άǯOl߲3R\A:uBXО-a1"mAAB]Zd(Ork]Q>Nό x R)0z{wMk{ Prbj5Zyqpq*K#lk o Jq9-]܍uq&8٧RSSF*V +x LNH-<'=(ed/f78͇J yZuB3Z_\"QSv {xdڀcY#?d&Hrm>yNuߴ0  l)=zb%>$߾ؓEL*8V04,9AݙckȊPiNٝI늷 E{WҨw0Lc: C!ٖU^* 1 wZe}ت 'ڣ+]謢ձQ"AgA#%U^8;U:ߨ[}W4|UMTo\}Ӵ,$D:Wui_ލɘ<;Ib4qQ ~%|Kꚜ_V _``xx쀊ӏeOf^WTS!@+J+Y>E3XpcKmC3EKnŔڈ⊕ SYhIcjݺH'()*ۧ?wOv2z_'3 rM-n/Q%* e.>lxΧM :)Ɲr!rПlωqd)Ӑ;m+Z&z_ Bb}9[1xҡJ_ * }&dK lU9yECoNEHM_u8Y߶F4(eDUv#n y-z6^Ԉ"!z9Ċ7 ڤw-ɠ>6zb$i Nje>Mĝ7>8hH{7BJ8#-!zK=\. CR6#krг(5ے4*ڬ$P]38k+siw*ʡzaeF >әOPA^T Hb[envY|u݀OHiM|EG,3E=G"*SVc$p /)EOOFuBC9fr*B = Vo <)|QJPz2S|\fVhOە9ч/?=Fd F7VuEd>8 {=Y6 v\.{cl$"ЈGBy֢1A[b|>șD[LE+*ǣxS7Ap]f~h ^o[N":_ifݒXa@Ԗ |Xx$G tf[G6ZVes,9(`6lRƾlE{dtb8*oݷU,r51U3,V, UxcS"R)_@E*2>Uc5H#cԁHjǃ_*ڝ}1U m(*1U7>*BvlqWPeoh; b$$F[)ZPNGqG*ٸ1(y۱ܑEOJ*@JOӶT@n:zNG{|$=FR6SnSG "R04}Oϫ~6#kgJ{\򄚄9: U JP!5+E;a%G Țd;ZW"ѢJP jǩLSbG A\DMψ - ?IUTI8!ΙT*:U›Tp8o3 ;j'o<¦ȗS"G~јTsj9G7cV^_W)0Z~>*/hAxNek[+qj(+Z)@V}zV N<>~}XG24rt}% `ltG:K(9Ƅkc+ٱzlqסHFau#| oo'%e; 9v5lAݟEf+-CH_%:BG| Fh܌+5#k(ܨ#oaw52m$ؓ@l擹rGq%#'N#@%F~o9Q"LQZ{3+FY)&Ki.Ʒp;%4\T׭~-tf+ ߻fK>.)*j89eYmy), {'8@̌|AEX)]#&VB훂^& U@VF2z|!tZjYU lIqu9jWvF|Ry7MOӂ"b*pMf*nFحDHkӐ@YgrSkw ĂGi^.n,\Xoy)@+ Oє~ @<;4rrq6N4 _r/n! W $v[oQi!*+BŸ앱 R?[:P 5()8;r=3@SOV`iIsߗ): \$sfӳ ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t[U±"IzW,.Cn&Z^dP+HLJѩޙ[91.LSRv8)UĹfz)<$ iw7ie;_HVy/ WLJ((hO_\2|w*])H\̿6*SD)bTaOMFHc^TDwқ} ӂ #Q*Щ?Y޳ǫA(>(,v\(<g}VnN.L#d<–SjFk皽U=qp8fddEMiIQt=?.e%;(ܚ`F~reB:aV rSU"UkJz2"O8Ǩ8rPݎ>'-C~;e:C!.~ mӥzb"^<4|ƵJ# n^@W(F$_á?rsV㎊XENz$R :+5ބj)MC:mPwM [;,th5 BG7;0z xESo|' OEF篶d {;\Zqtc鿾R*;;7AҤvg&@-K,#E>8RG^Y9Uh7>;֖*IP[JʥbzNIPIU IJ=AH>4jlM{׮\rRD$R%^܏|?SĻQh1?BPu3B0(ir4|fPh*OK=MlR2KTb¼N` ru2PcVWrhy&ϷO$\bT>$ү1"5M>X_:pHa%eT:s9h F |sQXžG*>yYPdA%1'00#jvlvň;],hZJ(2ae,j9umqlJ5ٷ (p^n#FX1?欯S$~Οj}n{oLYYi-5#ee|n/p^ BբTRGR͓Jasq (2rqW+_3^%@SJPx[#{2JOiM*?g Jc@G8 Xj:DS%eHW Jc*htdRmRz p7 K|boy?@횮rѳhiF(RzSt_MCđ֋<=$˛WiG~.X4!Aٜ|oO )mKDnG9V?WVCu%_%ja(0ʦlӌg5 bD8V?7rOˢ7+4R^fZ|;}+d ̗Wk)DIUsшqnQ#t (UA+p-OFrnZQ/&4`6ڃ"|8c.A([!~N"UڪP2و)†n;7|_8t'1'JJb1Wa/R-Q&v$%Ȅ+Tb US2J#F)ҪK *TmXCLU^J1W=Ckキ.JI{dwbBߐ T+BK6;uclAJ*-I w WP@=}Q]hOQ6GFӛӸ F $S$tjs` T(r22&e X8BIC^Ǧfw*qN5X:A5IUG Aj T5vP0ASJUL"jGS +l7銯v`^ׯLU(gwv;U\5~4هQѓ8U RN̾#ya⫖oMO2zT<+¨ki1$uWk5o4[FnxK&[y6w߭!=XReȒɈd^O"A]  Ag5&wl qOmNruwSszц@SPBjdƀVIEڕR\Rkw>FKPu6!HMePw*4FDk+0kyzF֘!.E5aJ67Qhq$L^8 ڪbaOTn:uwajHdr={ǓE$Ә<Q0k1x0[݂ggM0O>Fao-mH-Vcr$oU%|^_< fӴ241uT~w.nn'nU27scI:R*RkMz4ӥ]7G?E~-<ҭ\48 ,+ALI0a@Ol*4 fPߴˍ#: KbF/e/ Z26Jq+t*G$೸; ֻee#eF-¤T tJ/Cr^=O=`݅tT`ُE(rNjJ%KxhɓV^U=F ђ ({WQRpB*JZ.hEZFqp rO4*Oc*~.jÈ[ nԝ /۩$AuJ ]V&;* 6ӁʪXȝzc1Ba!x*kQL3v0dK, YCΏ >5 !l)*ƖWBG8Ul=XU%ZPlW;=:n /UVP8 FiͿJNÑQeDO>JVf*(5OO$B+['.,TVowNCUiN`#_NhV#`7PMyq+q_4 ka EҾ=s7gnj貙"@pA iRjfp*0D$"BծĉOl)МI&bbHGJt.V O?Ϯ@S^MB:dP%aB~ρ JpZnlH)LdWh:QA Yjsz3H6EE ,hH㔵|~p[s)ci!TbfjxV5zJFw4/b80;폞' !+зqO)%}*¼$/oZ>dtQ2pNT M'!s'z훇{bMڞs5x_n]MrW-LY ᘹcEȄAD)_%^ngs*Cw4YL)+`H{lz՘o)TFTQA2zTJL5Ʋh{q#pqUvs ኣvw80?USԌIQӔT =]qE~%P €HF늡n d<$(**trƀ8m"zᗐ">$tZPW#J|JA?deN1Ve_=J UR3pr>(qBלyN)]m/j1&o 14ټ)9d㊩nwl @8M'A0Nثep+}8D='cP9s̬݋/~Qtk'HͻfYWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t-lG#YzL^5[liBT֛=bn-c5VV zD[Ү/JYkB݇r3̼p?b!gtsgZ.Y>9)7j^[Ч;#$5#W+#{\CϵQPu/,$WxƊEߦ͜Lk"Ńvp|Gp`Rfq w߅"pp-CXPո:LR C;9Yl G@QW^wCVӬ)Ш`g*қh6pJ":Hsyίy"}E[67PG:].7&k44-#6Jr7 ? f$I 3MC*P(lF[B)7'/b,@Vdv24\pi]#u?|+Z8@XMNhA  R+"S4 Fx,T|T}7#t suwpt|czxl4FI l}B5k֞;d|ʥi0 ] f,b8m!Tw8l}+PDʖ3"A^ukjPAGq"T`H#l^eA Gua2b24 (B?QGОFGǦ M 1.S^+9h {>GJ{uq*:mܚ}ӋݱQ4s$,C}8I5ҫgfVWxV)hn]ڍа޻S}wVDߩVjW(+N5n qfW_tejj.koc2ZM8 hx%^$II1c۾HFeWRޠ( 4Vݽq4V: M@ :{a -r~9Qaq4r%hvnaShaRiXzrHGl eҵH3o|S2AQ=;\x7Ko O)*SAXoIMex|F./DE)_ d1SêG0?Sn ˆ4PG^bXO˚UPGԣG:ztX=1;1uEkY=XƠ6i>#HIF~8N*<2-^>4IcS\=( R6 IVZr$~2Zec[yc߂݊_jOre tVNNKTD P(0:$ LU}I5( ΨFbÑ? 쀁K]cQw\rb Pz '5H+87!e.&8N\pYT(h>dE4KQl'2.V9w{F?1ηOOVS= zQ JuLIxbp{'n$@1Hdf(܃^ƪIS.(m ݔ~d|YoxAW8 P^8# @idUq/ d>Wr^j8RDB@ *<+ulMUJ}f a~o@_av|-Hv#wjAȏl4xqj\Kơ:$5)d5Y}8 J!+Q7$IQZ&6bE] Q0e@hCQ մWQiT^dI2ً,t}wc>?kf'1 FǦUYU3F wȶq-w#^, /mDx>~ [.Օ~^>,zvr)\kj`EUA@xXW1` J#(z|ECl½pVΛLV01rra mN[*Js#dZro= ɂ82|~xq\K | -)N@$"5/qBfaJ;2#Z|4l@ HUz Z!2k_~͉-`XRzG5n_km~ Y()=(M? ,7{1& lH-D&" {巐We;s <,8:\qYyr3ŲwnjsEo5ykD7mF؏'lr`5pzoP Uin>sSzlHJM6O ׉]*GV(A>KtU#\և} AŲ';#sC=(1av# yxTQwhs)hT0=n72q˳)0 <4;O@zrJdy X z7$*CWmtB )@HJɣ8 +3jGvHȁaAOȂO.nI,!4ףpSJqLɶ5MRP.IxlpU1ʔ$צkE 7aT&uJRN]±mD_{ܺD5\袚ڊNU:Ef})|͌˓iQD,3sG(6A7ɝ *A':!؀:!9Z Ŕ3*朲ZOh"2ӡD*d_PZS፴".5Ųz3;nZ EH5~UnNL8dOUӠTd#QXhϊ Do^© e $9IaSsS ,{Yjqt5bB[WmH`KhV32]6W\x=J 7+TmJu*6I4UQC*p!%۸`GlU]Im4bA4^R J|oWdr=T&UmdBx? B26SU[WJ;!|U $3Z5AQNJrCFPuYb*XxbR`:R+QbR*C19\ЯJfm\U#E;ݱlUM. ,17MOLRA4t~yhqV$*bNoW$ c u銢derqZW(v=*K)P6+CSto1 zexRMB_S3A}?? 7=ؾ9Zq{㹷t6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t4Gj?ԏ+?/KyVoZlyN&@I2JʀPȭί%0udC7E VO..'ɲ?< MvSRmSaǖ<&1 i)=Fc}Nf W*Ĥ),t;>mB%@A&lv\ZJBx6uyz8l?,$o}u -ClӦOQx3&5ƕ!mYc(eo-2|dv}_È;y[K YQٽǀ@8SdYU`L P6?w vEV9y-))nS텲M*Jz0GSJ8-]}i`T+NN^D* 51 DC'"0C7(v?J}[aVSR4@ F8'푤bOqW~n_ !2ރt=I̔A4;*i7kT){`J=NOq,C,- RiQWR$ u'*yIT@幮C9_T:VJN~=05dcSoޙQUVRE<2Ȁ ,+c!cFZ]a&gɤHVFm4]GJa\E#XՇ@wt ¿b$MIhG";ucAQ7Pz;clh˰khc 1CZ v&Ż7Jb2 nٚS\1y\]!]\ԘQE+Og2Q9}S9-BH.+Cms5ϨՔ/A!~e$;Vī\ zc8fp$*y!^F={3/#a_* =ˆ#=xֿҵ#<: sE$1;TnW+r䇕?F)_h\RdyTK!f !+1 0#z I#jiu^n CM/tG2٬9xqRC$юO{vHPk-hK~ʜɷhX"B7~ EӉ#)H'e"n[Hͼbnv/H%B1У_?!yRWT@<[oto~+p;Ew-6-uT}U启;j?omu4 W6yЦE"GP{70C۶tJ)i($K봑B!(oÂ!`O!4oL*v> /I縒>*Bijk2*+& /#%cin^QF~"*93;Hkά@ OAJkkIR RAgv_2%?0Gj'hOW67.6|"c\N:4:tg0H:lD@('H:4oLE슨ji}Y M6a;*^-SF*N*{q#^dY>|0vWw;ћ("h4$t;ѩqF,vog"dGmAuf$@F`pU0 3g*'PbO -|@רVJ>Kom/kcW첷rƀS[2%?Nԣ+\i}A%L MW c0z[f}AJ =IE QWh C2OmrלbZׁs?NihpʻJթ#@<|NCy8 é/I P 0P ,ݶ(*>ئ%'eFSOP0s4,6׍& ]OLee :607B :ArآѠ=)9zW0 E Cd^aXhsbUӯ#I4:1!WvDbm~27ђ>Õ̴ߌP1o9~{t J6V[k#w W÷s~`ڻ- 4͎1a;*6c囤K$A?/ ٴ₲V;&C%?mѶ*r7#E ^S_!ɐDr U@\Uvg$cHƀ"g'qR&%1P|, ~G!{Q[rr&dJtRHZ J)SjY_ZFj$^QkːUKDNƽj+sHV53 pe3t Yk@6j@nrۀ ABc?Qr܊blw)E€-iR;RTY ?/銩zRFHtS늶VG%$EjTmQ6׫( #|}l`b W*h ׸,]@K JBE7rC/*rȿ ~Οef_t_8~򔃠DWaO=wNsb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6**6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tDWjHrr겕FVv0jr- PHJLI۵q&4ˆٳpN8a,Iw0yUb #vx{ںc"ՍvέcsR8AJ|.9NFv6VeTv=U cODIxhoX|-*$P=45BU+EP||q3Q[]~K>T ?i`2Y-²HľRWrFD)6޳I$QP5Dç>hexv6Gy,̲]%9&FއgƓ4cH߮nq }.1+tDz]Q⨡Ay/oRw/EK.{t pG*z30jsv܏|%. 뜍lҁH=XWvRׇUn;uˍ:94Rco&=?~I  X;iPz(suSFhV NgB#1dZ+0^x+Rmrq&#;?vTa错[ŧܫGNT ji$})y${D-IhpӂEc\R[vEOXyȃgu99֠ =xyDvWa`VSUhc5բQdAۗNzbx[[M8#.LPݍZ$"\S(Z؛O}ƣ v'xM@پFh[-PE9CLD( mjuw;}zdCAԀU^E5`LIj݆X']7J01 SEf4*u7À>8$id%S|UhiOqPh}0"5%/䢥 Z \D ;SQdRс]3#I/!$/|y8EQW^Dr 7%PZ%Kwv-ӋW0@,ͤ7WV H&/j6Z0B[nPFVo;y YWwwa eǠ?eT}2K]Ƙ#/rE lv F~6w!ŸfNcM"z:EF;[Fdzr> q뻉jQF$l(T'{`dvPEM<+ joF?[) yT|@tLD six=_)"H׶V] #T tx9q V揎> ITKR1TgKo*T iF?aagFRJ9oANm:AE +VJ<{N1Gpy vY4dE.~*R<ʯZ⫙jF+ /chhdʙ.MRy4B%Ҡw=CSMOnF6h .wo7eY$F=G*;u(e~H>1Kʺm/#J=ij}{6Hӆ'zpB $i/k487ߠݾXje{%Pi1ЁUʬ6>Io%滴†E!jr^yGV85;PDE 2O|s$Q֫+9 -)p PGeuz"r@orkޟF!ȎD)ɍXm\Fo gH(j{AP1 >Y!+T-A^.؇,B)¥AZ-@)ڛH\KEqM TM $ -g鎷oE]M9A^+dmJWV^*_5`1M+tsAW gċDOGߑ)^)&}v^E=E6@+AwIבKv io˷*H{ed-7-r45~޼zZ?Wwzҵ =Ϝ#@rk<9sD*\|qIX IR5d+ e"M$AC*ڨ?C0S-d.+U}?. Mk|ן_kK&P.dq 8-irhz v\#Eܼ&p+)R6WU%θڠ6)p`"5,iwˀG>#ٗ K%e*,GY 1ȠmO/Ll;ʑ=̿FXXIIZI[6'6e C _,Au B:$5.2dgj~*&\44pˌO.=ߵoPml W!f> Ա0[Y({x *!GRhr4̫H /ZWYX5aZR׍6=vlIZ*Mpn'?ې6rYYB"ݣEBp*If@,2", )B`,0*`AfT>ɭ7Ʉ!e-M?g }rAjH^qSY?vc3*z)S i޽QQ_K CA[Bx)LMw%*@;m!)98ps] ?6ؽ(w!v,qǽ:m#C="9P0Ӛ%bor-T!`hb! rSP)<Ґ݋nѻ,ʀ7G/Psiz}Z7$Z7`?˂I)8CZZqoB5xĊkFRHȟ?Y .'^>evFڣf: PԧKr`cAv +KCurQ([')\l$/=k@ OMeS~0?o2!ПUy}&'>ʊ#+HY(l@΁[D[_$Tԁn#9|]"8Ƙ }*ܧ!@U |k5BSG3H`ZIpCaPG#rn.!fP&0?'Xkg,Qe4glubƯu(Q{cszmW'd7Z'fRk?Nm85AMs=_۵2p I« Q+aS w,#AzssqQs2s鯚kɏьT cVK0:*҃"7j:`lҘR8T !%u|7ŢEbܝPVp_bH'p{ݏ5@0oÍE<~e%R&$?>¯9h6i8ANÈut}O<Jn5 _;IZ/JxsPٍ]~T֯(J#N0O2Y,~rY=Vc@s>rwmz3e`rGY/O:+R陏+2m'!,Ll?+uZ~?~AH`lMD0r%*Ȉ (TQG˾$-E#N ?6\q)Ӎ3\?r\Lr`F^rs()Jqy$WJ9~f=ʫHcNzl懺iْa**k_`rP]DF d/@jim6C4'ˢ:Dg @&~9|8djdGmdzs}oQ45@S]e!Y+qqcHz)b˅uNVP9LP{lGS|;'FcB\v V(PݫA= {)]7SNCϚG7[f4d n퐒AUCRy S[ '$$ĕ~&%>뉴l۠xGzp~}IjǪCqVt6#_V T.'jwe˾Hp ,H>nSzd@tkgzN<m&]>a8}cpyЙCD7%fSkgCČQv&UN&.h,ebWwU\Ε|*4T~snf zlGb* LN*CdJ 0ܓʭ^ULy" xU!cvQ4S $uQl#,3OOO\τ5,E}_m.ĊO /,¢ :v1=QW(5ٰab×?Gm ꢃM\JOAcGĝDM)׋HPpSZt$VB).}8dԎAil@y;"h`)E;: %^`~.*˚yVhp~  ʢSIǧ0sҁ[LjYw'T#YO.L Z0U\0WZFjlBG*s;wf¨SC[֜lU `n .{&Y'''W?~_/sR@'Hͻf9Wf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t<zR?\\/EZUĭ*h)ϗn2а6iu?K>A. O ۘ CAr 9wܥ\Crޚ0AzB8RNŝ4ۖNVQY< ^`ߌrz!}B֤?khYP/yN4e٧a\{{WIKui%̡ q41^%+J9n0 -+am4FA=^X(iC)E~B㑏jw"\!kQbʼfշbנ:DPz]HFB _Ey8Tx%ZyR_YDq Uf4ݘ#oƹ>,4gRD(ˈ"5UP|r؇&)Ez<„`kے^4H_L u2q5 z>==Mǔ|;iKk_HSRAj P: XFsH+ק8UhSO|q2~rC1(\)_yl?~ kkq`8z㥢u劭BXSo|SJ1GF5; Z@ݨ:9 P04oӮ5F_}IrrE.VY?}] |3OrӱTtoI!Xp%Gaog/tWfP~xc Xê貱~cu")VGx2]BE5ƹ˼8OH"6Sen%rn#W.{aP@4 ;|*̲XbgpV)R6!NNqrYo| W я0U(@~u呶2ЫrU=OoPd9niSa%ޓԅ`EBNT>a-\C3v#@AUO|q yOPA&71Vk{L?ZHOՙ)|8iHa@HZ1t2$@TEeݍb+QڄPPב*P*/j}e0rDHܐrPHS(`Y& е75η>u'Yc4PVF_ZdE#f}`:oaq^>4鰧s^%D`q'sLm[H2{:0W8#H OiOL=ǘ)8"HZ%%eF 1j$a#QHŸ۔ZW`T׭0kKq6?V^f=XbeɸK"dQ)\$\DjTENCǤ'TBh&k`?G|.|4Zt癤1:G|D-4N[|`Uz&cKBJ *=T!mG 16"Stp2X`l9 z#lrcRNM9nPV;sh~j: ʅu1$2$7r21SN*_?k ZG8`BE9>׾bɩP5LvI6QZ02&9P+(BBIk#Bcwo4Y Y>1e>`ЍՓ+Ē?[N^11/ y5w|<j^9Ưl^;o0^ٙSa&,=*z gz\#TpnH6}b?[]|i#%^ȓm jvdmV&|qHV~ abTfJ0 I ‡ ,*E?dDtnA%!rןqJ`WL7&E2[%U$קL :_%FD)`{я:w exق]3UYg2l9AD_WJ۫Ă{yYT+Q0Q0=-kvaGkU!h!dT gbg!-C1x+?ii<)Xf}, ]my3FzSzB璇cCuCQNKQm4ZK~B9C)4d?.٨ i̷0ql켩JfZc8zҾ+m0@bR_p|ZEƬe= {F.o `TMn taqhޤn >YvbٕR;sz 4|%G7"~ SdzJLRۡQ,F1RT"9vw߷U$H52w΃[b'fo%!\ G*ESb 2E$T%  )J6m G Ö́eEą&U\&`Aju=2!:2`;mLGq(3Ƿ6iI}_pPvjmnl>Gͥ~U$wą*+,$;bZ*VZVqxzwF6ZGWh[7*qX%m [I@ Q. Tra֙<@(w1콎tKZ0ΠY@ݱ|@tOk5m-M񕺓zG^\>!OkGC#yj) AnS!X<:f ?nbATZ iPP>Y # -+ȀԶ;'!זRC/B$$-ee[ԦƇ3Ba\wQ;5:"-Pt֋z.ÍvoaN4\y'/Ll8 .x`i %u~ٹSqQwIcG(1J<'L㊮+c0 s+(J k- 'opWq*Ȳ-Pá9Uo$gs@wZ®%9\0+~iJPd1ηBF/LUe  *k،U VF;tW^4LToPH)^qǾ*,j~<{lP×C]W[II_|U\|@_ F)XXК~]:*>SM{Uluo{}:=0* Ђ6VVGM>Y? >Οef_t_8~SBy?G8m;/͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tLSO.V_֗M@s1~քe(0)RwILd2de!EAіFrUjIp8t9jgnRvx2li6qP>l?.C^Os^$9O;$U"txa6]&1rZqOgg`Ӝ<+./Z2kC9i7WM6/tGJvYFc'UGCW]sZ_g} jM` *:.V7 $j=O(woLT-)^Q}3^ȏ⊾§Dw|CRiJA,F#aT)#$AraTȦ as؜ y*x9+\?CLU)ԺF4*$_;yփ=r%dO\LE#'ș; ZQ̯ɷ82hS؈W%lTp[*Z?g&hYeP#4"8ȕ4KT$J*s];ı"So#H)1J bVE,`N!RJɃ~Uu 24oҔDv}X嶕$ܻPjjaG!Ʉ++`I@R8Yd;|"r AOq%hڿ, 4 ?dBc&8\J׈&^"`$;r(@`MkZ y.+Y21 xj?)J $Tc*TSJե:@Ġa`^++lY85`Tr'qM4?{Rn՜?E|pъ?mlL@Q j$\DV5:jç'S{!"wΣh1ZY*! Y[˗|EðHgCk;"i*{7ËK‘\J lEo7R%zqIY\,*6Zo __?ˁ!S%t2)=`J1@7z-j1mt4ZH(^a*j 6/qI(% cJq" GM:uǵqcP+-z$ BIQO 7^1 쬔^FU 'Is26+wfM-J$Y@}Sv2A$ DA^Fّ" 8{_)Cߗ^ªs.J3hZm6p#CK mOt{.N9_;DŽPK$h RXa&Qj61۬Ԣ'ޭ6LgĞ1u#.`^[51Ff=[* UX<pSӽF %~P/J5ɴDIZO~B @uͦHffñj+oYe‡ GWj*΢:o"`B'b=HI_}1)%"v0;HyV6|Uu1CFᣪmD5Yx4fef>e͢+J|'lerkY()|{&+s+Pۮ r4IcRS GDLPd=qd42Q \H$| #bG^ۦ*"E];J cS@]1,dۡLь`jaD2RX҃&^F0vMsl ÆQo8|j~=΋dI^XaA(խMkfǐJo.1*\m!Z~^N! e:ң'ǑVd`#NSM8ZBP/×lHK>3Bs?,,֭jʑ@$m発s Xi= &L狨OJ*r_[9)xH*j]iF4I Wgd:|!GX8RPQ8&ē@6dvhz: JTWNfRX=*r=\Pٛ哐CA$2xc5hp& ih#jq91"R;'% +%ώĠ{U L.D1r^ 0hϾ- 5aZr1, qJ$1>Q֛t8Z\~xQ\Q{֘Y6|;KI'?:`$2nwodؓMt.5q邞%ddtHyu0!Z5gKGjjw\sm's=;~Dj*b?g&˩'[}nƬ/^$*ڬVa~-c@EoQjmEZG(GQL|EG%  KN f4qQ?;v?(XިPA_-ڠ`4(H )o#-T"qMO;;ĩZNabhFqBQj U%<(TFLF0(Iր_ʷ\W,C0,<64 S툓aՏ=h=H%~cR󪘄 Jֻ xaO\"u (CrMiq*#NH@e%OTX"B 2lB[emRHdw lN !Íya{ȗQH:h.ыnO9?Z9M}E<+ҟt$Gk1(>Fu2t#"]MQz4("s^RXL)OƸ " DQA>w PkZK_J%^WBR6`~fSILL9HiQV:ڂ|`OBKҋԱ#@V@i׳e9(X1BaT=}6(Li!;rF¡x1&]YQD%I=O?P+"f%a (^h030P~Y"MF}4bN$)ȝͳW!z`#;tۦ% W3j)u@vRҞ r 6H=0kc, z jx\ vGP*[,{LkvaY$N]'uVSUniB%GsM/M:2ZG/h~e"G.JȋE&V)1$I8uȁi$#Av̥Y#_y;IFD)savfXp߮[2Q X:PM(qQOm\)_\IFX iVEw|qjɋd W,Pwf=| "2 4T+ n|pN>ySsAjI"G":bw#y ,IKzTl=c? @6s#qؗ-r?ϮYk~ƻbҩh F j I;d9 SSPX7dݒi/\͎:~GU0_ \W>O@ քyyTZX~ (6h Sp lzU 6f|a" nWgk, R_csqi{bJX҇f4|jG݅)\V;Qޟef_t_8~SEwt6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tTwwG˕S;X'c |I!>R?9v5=1UIhGO\c;Zʲ.;.?4YF\&ڊ d5ۯݓ=:8V07L# v !3?{m4'6k29~y/qYOfUYv}p@%yt\BIbSЌR"U8$j6LMĴyly7Ǻ*2^HRVQ7tC5*a]C$)C##;XX1'aqJ~6Aq)n*)djƈ}8ˊGŗ<UEieQav8gaRGTK1ZmfZhy $l81im0jw+V$lleOP-QR76ʛ( (僧Ӆ"e`TZDT {mďKNNjA7زZ( OQ]늭 P^$2 ,NGeYYnH@qJ)W D܏S 4 $HZ灦"y^tcN]Q Xt68ٕ׎o_q&YIR?L3=4)n@öIBҝ8ey PwߔoID#iQ~1H(ޣ,  -ංͮI Rc'#+,%XƧw.rC 6ِnCAjS!TB@qZޭԳZ,fKe P)pPhѳ[!s>ej2 wjq(I"dG=sf Sf3)MbO~T)$V(}:,Kuo|m 7j{x/l1A];Ni$,ȴ^ *^+T(&a>!ޘ[G fTIwTM1 KU 9!X٣*PC]1Bӈӑo%[!TTrqSH.c! m_@¿̠3B-hHP׷?uPVU""^yR m)\?NwQf25PHvj*D5B[b({(ҙՂ &q9̙ݥwdl…_jץGK* <*+J|*fRoQ#H?vU]F}9@RiJ_KL:g 6AV'ifOγr*n#`1%+Kv0,ol>MD,~ҷƻ;iDaϑU<ا2MyeA{(E E7=9^s &v!Ne:U_NE8W*q'@zomB]! 8 /Ss6F?~If!*?V) TU: MLKMlYR1:U 6FwnXkNq9"5{?P R_bp0"7OI㱯ݕ wGZu0%'#1(,awŰQeiH?x ҨI[$v\0.+;T %l$P, qL}F r)e ׭>/J]&v#,$qjB,FG}ٝ>^caR\҇+ҙ>B;/~@ ߨWp99HB)”&0JI!/Ƭi%N$ n7*r^c6"(X!Gu> e%hL%W, %AR{ #%rM(z'j݇ H=vۚG C (>R% [%A -$|']x e! Ptpء'ޣ.Egcni Udra3EoLڅ Ddn=OKY흩qZ`&S0 0qċF"9!)\ 4*X+K QN@)h6etDs~Zeknd qĞvE W#Wv(>>4{xH -؝y`>c $"ޕb(՛\Uv {n֬mX$c5#b.xY6ANm妥![oLpt?QPQ>QNrK [,+u⿶>V+2 7zN;yn&s߫;.j zf{BMjjH04ԕ5?K58XPU`hFon}ȋ%InQZu8e)O]2BF΂E?'1_l^jk&cۨD*o*&7 O5nMF\4`B҄dI@n86+ʵ-4"4> mIr #6(dNoU^0v|QL $pB >ئO A=h-&YEVpOFk8KHjZ޸.ЃZmB)"*O,Y'-kF}Tn||3ŭn h2+{2BCJF@CIS2OB;J 9;@``~Y"R$ LG|Jy$gNͷ,V4P/lZ57q&%NX=5k0XG@x0GJ[Pmzr%EĀf!;(}Ae4I1P2 rǭk,(Q:`GzsF PWhkgӭx[=ļkF?\x+tĝeBZݰ"z#>c+ M4;ϟ𞈇1KAJfµErhNdQ4gާ _׈))SdM4ŒIe*\P01)g`oT6DGU\fTr-d5ĂC8@ӨCq f#z|]@aZHUBtۈ:h(K;xR-廄 +euIf?Հ֧ )V.IA!x_\y#X>Z9VxV"7ڥHx吗 ?B^i9$!P'8M2l-yN ծڢ>[#GZ֟0688 *a1hmIJ\O.~t<qcNbH+%wQ^%ſ--{Ǔ2JVbJEDx%9%:6T\%P܏KwXh2HрZZ׿<n'3y_8fae'̈d#w'c (F-ٔHfUȵթFssbBޗ_q)O{dFMRII""N8i Xy-eԓم)"Ia|0ǶT֔߾"GcS{zj2ӯNتh,j*##~1#lULH*9ᙔC1-hs <1UgV7 !)xc\>X}=7SV¨cuPAZ5$1b\1B:c5# sz`T$2%l-B{)\h ze=bnq^X׍;xdTmCqmP81C"jC3 N >uiURԠ99V`鿿Isߗ?*;rĎq:v]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t\| ?ԏ+?/KykZt9{JACJb2eJeT)⪊P۾ӵqSE8aSM֪wSeHI>(G2XJ9+vAR7+1qD[mǦ2V"s,2)Vf, Uzu8/YboGȥM=Ol@ 1ym 9JCɕ}&jҠwYtSaa3K$ +ÖHorE D1`碵~&4lٕ,y2Fߦwl^Xѕɺ2a@op*@B)ܔ(FXЩjzV!ЊfnV猤ڪރ¹`8:xcuxx-ZOpn$CNI(r, bJJB2(BG%oăLxka!{/7GJr@u;nѭ -T/.ѩj֙1߷IJ9 9ڮ9EQ+c" Ƭ#_oQd@VO-}mq-gPvsi~h)6#~_N.'쫲,TV#"x>(rJ@+J7Z":{?.5g 7m/D/yb2Ҥ9;)yّW2IZVDǃ_4O+q+2W.a(!c,-i(ys(dw_W\(`G]k=>Cs8y5mBTzײ{Q֚Qaw9q%2U4Uw{)I=0IOvSXM/)MGq6AEڝkSmG^G?mH4#.Mn8n2PlqrܸMy}`P:n6p@#D("U1U@mKYhx1CDj$R_(w [QD! ʵӻc.YJ,Ii>y# ɢ`ď ?b-T9#~kez|ʇbn*w*BL=GC.2 GɰZsvq8Afmev"՞|y_˭`H#e= v9|@P>G@@ PkC.V60x/É+fFgTYXrǘmᝍ:,΀> XғL{_:24Qz-%礦`~, \FbC"(&!$?ے,6|qbYb W-+\q9Xl4@o94 +[s HVr %gh%z"*IrE[OZ#4,QhdPwW $&ӊ-;Y.\G;zRX *SkdrS4m-wJ(?eƕ=1V+GFsaQU4PL-6'\D-mؑxbtʦ5-8#=MVG-r1 tiqAQIm%0Y9dЩzvè 2QC5Nһ(~L^uecu=AZXB]GC'"ir5XRWch?| >9Ti2 pv-kcI |0 ᐸTt+ε@1c>eDd7X]i19= E"<Vr?`!S%XldTe@ڇjqʠ@F$nƻ7HHM԰7"V+QOl MJc\nͧ'Du?r\QG.2Gwwד YD"v#ܞ9e5"VQ{- wvwoF*08V 6SOYT܊$UQ+Ly2 Ef19 `SW%+QRA|mW:wǰex.SM|'g>#p6KɊF U\I6v? a<F|r,QBv'aL{Č>Э7ƭ=vf <<]Pހv;E1ٯZv냪 0i7'R(in`Goy!t%YۭYFddQ 瘌2=FM!&Bdīs pRXRXq5ޜ2RG|[ ˉpVzb G4e1u7C(9֕4|+^iN$KY^|[AOr!pxpw2A>bMiQх_ /J(ӥq&QCCۦʙE>!Њq9AȚeԯTӷsw#O'=٦43C6~8#л}W*F (ѷ4UaRiaU&_v'|]ʮ*8@z !BI<{I$!A<[3آ% ;Ηj@*jzfQ14ڽ1*r[u9r@?>IK 0C|SӚRGxWrX<ȕ>Y'^*¿fˡA) TTTxtljӧڡ%ܡ¤Tv;[6\۩ RX?u'V!3pN3_‚KPM6M23GDapIY{b8+هڐ20˰ԍ9E Ph0(yLkqC ;u7*8m`Vhh7=%N*׈5ރYXqVvm1Uնmt>\>X~읎5R*^#_.*ƠSJ:Ue: 9OL y0{!! s:K ,eYO,UPG̐wl4Xn>?JSP02!z_L!Y pB2UO|B~"#R ,d޸ԁ]&1>Fz d$L 7VZмe(:DR-ˆ#@Ջm@?eVɣRK:c$+9%HQO݀Vo@j4Q~ќ"?Ƶ6JK}9$'LE<|22FFΆ@MԨ;S匷8.NdUU*QRzoVVXa"a,(NԐ37xW'#0ėj>\ij]#Y@z/bQ)d׭rv\J2}^ǧLBAr <0ӈd[ܚSբE,D,`vOP ׭0ZUABT4m259GCAִ}%N!\VYY U`9Dty~|W Ӷ)ϛPj `P$ {8[#AU<1r[5F?xvÛ_"I/*w"9=|l&iN*҈;O4%G$BtH`7#sEVrS.1:~釰X<ۣ=S_s^Hۛ#,<^A⦸Z6'0j%-.&etzqa0ڋR23 h2-sr?8U$+MN?XiG՚(H#?kG>HQᷔNfh~4 y"ई#F8V|~nz)9E(/Kqo~_Mq-qBM A@w6*Hj66fk%#T^,\R!*~gt9s6Ν & eN45Yƾ㒫W?- a.'&HPM%򵴁bPe`<_Cٷ54ӄS[Kdc#Sol,]AS!!%Ȥ9)Jրv*2[hrE|_i>9&/R*rO{9Yo(Bh=X<8W wtB,8}9kSo{dA!%!jMiI ߭@y {{x&zm v3b78ƣՌVirGeRg'=)W~ӉkjŽJ!"|{, rZD VWhӮzcf*d+jcVjP|M+H(IlUz!ڵ4ŽB*:*>> តb^EAO}#13Xʜ`Ou,:Yꅔkq9MFN3rw1_]NfK kޭ-xtH5!2qߛ\S.o#[$Q*?4dᕒgdOXߩ1Cz#jug )6 ri%"HH"k'omYD`y,- BEOXrǯl{) ?"yU9FMw׽O+J RSj {0q֧%m @L*+q#Ih?S%ؒ/^+h*8H]qmgV=)ᆕItPn|ON$ǚ;VEW]]`ojvlj $\S=N ҃_nINTp# Ƅ$Pw;s_/+"Ø9'd{V/# u3yF_XrBA"R,-mbh\rz3;}ɚr;立x#8\]& ϫ?*r#/^c3`hCqu2KљL#p*nl~yvaEn}Z4{(;I@0 S|tS M)█ZQzd si*qUĵ>Х0ac/_ H+~$ L],xאi\4k'5F`x7V[%ׅ*<~yrU=ZuqK}"(rH~f䗒pd P^[-. J3ȕ|rūn?<#LE;qU)VC'W @^;vۦ+nޔJ щ 'PF`Il N?֛=61[XGssP~dp-eMi_qH''rX԰/rTfXEۉT X<(ácuR;(8ƤÿMh6XW3=錻C~䈤[dbn2 eՉރҗ\u"/ǙP F ;\!v !nLORUye$">4Ţ"l+&>CS{vo#SL$*~#Sg 5 /O>]1[Ķ5HR*$$P xwʑ30@(a d4^MIr-ӕYzָ"-'fpA˵zg|b.5I9X/*VH(̡p*  $-LadPOHUElJ:p] [jzWȞ[V29ŧ$%n(Ӷ켕WySĜ mS?场%t9P6ZTVqZ#p;dHoL]>TfU5`n۩_i9!GcCFJ}SWjo $\ V[pS(Xqf,w=o C+U@u8萇N;b,5'#l+e0 GSlAEmnTfeQO^W)`׉w Kcљ#S` 嫊7z~-Klj74](iJA(dE~[aV |ZkRY\E?ƞ4;0n&>/%U70z7`6ο"@v7 ϠQ$hnkiX1ĥRk\I@KPjREpSBM:xg5ւ{xC^anj֪gd Ҥ8Y[Cxxt?F[ 'One,E$`~&){lmfՙ_@1 m&4?kU!h75 aԀ1'p ~*mH3l n䂆$VR H Nq(z4?,Tlݺ~?y7]HߗB$qոZ,oHtkJD|XW[;ZUj|2 3F*  @O7S 1;fD2?l" OJ1tFϚN,rjJ}9M>ͤxM@Lʭׯpl82\:4EP ˩![ԃ;dԡaҠ#U~8B\h21J"1""kgAԓ#|}){gX |A@:M z#||Iݲm#3P(}.?N1ֈ sd6ڄӔHSrcGȣz~3u&0 5ܩqVcteeزXyNbMFac^F1ңnU^ ;b'mLnHi^#UxIf~9XUb}@{ hT,ZRxTjo\Ubčٶ1UN#/훍H#*!D+'};UO6$pnۍN⸡TkЌR54¢lNjp7ڽZf*ks^qZ9WǷNllz⫚E@LÐ\Zlqe<'C"z㕷|P$aT0?[ n0%dLB2 FMʔt(&qŀ9io?7=ؾ9:q{RТPyroͳeWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t\۱#m ?qܹYZ_{Kɕ=9jC wP QZӧ0 T=J>-VJ_¸P#\@w cV^._0X1VO?"6+Lʚx%b+T=((hO-!},n4Slo J@i\<+-$jpd#fXbȨ=02I ёhܚ!<s9-gn_eIDa…=% cmD s5jsC޹0-^ǠKrz4ӗ"gdZc9俲NWo!} *d4bFw蚵z}P2sQא'nCVh*SBqTqYU taò]%܄ RUN܁` U2)߉!eudmQ zD:n>Xk%]~#^ RSAʼn]<8 Ѐ;JiP1Ԯ\)51KEQBȤw  )$.: ӊToU6'IlUTx8/!\ *9-z5hw0se97*0Uv]j [w]򌹣y6f t_~\=J@1֟#9u@Ϩzay|!گ:6Aem"(:ToƬsC)u\[$׷42l×Ole\-wSˉ9ehKTXpVB%HA&.Ҁ2x¥7=\O*ȃ=G_"Jٺ` IbR]7nFQ4q#ݏ۲*|T·yn+IIrx`i9ju rvxBsH7M"e"OJPWJ/_Q'p) &0 iTWw~H2\BL (V$nGOR c,좧qNiya>h& 2ͥIU$j/ٹ|/HH~,9K(Ï\jԀnĭˆ<שVTj ;acS*Ѭx,XsOE-<ؑN@8P+ɺk goG|#Ñ@ԡ~CnIM6-KJa1G-  7 B,nGJW/ҥ}_ENJ@NzFyU}ߔ{(xĄ/RvAIX@X y8̮hQTƟki"AZH=]I"#*QrBYEp}I2cp WIT@j:ܸ};D`CN/AoNHg&Ems)WHT:Ʃ,m'+TƒfYCN D(^7(:~ztkޥxJA%9#gUl ?/A_|kbڐ#ur@VdLĦGu e?w2P/"{2~j3,C^g-@"HjjYѬt;ʣW6sTĞoC4呈 ,4ql-^" J~u]JHeS&ᚵbk,3"e,K{%Cc^jW|F6`j6g['rv嶚vC KsEMZDu CTP}d̬`e۟27;g28ùl"@$l9ESؚړnB=;oHPðE9\ZU1L$nӐi\bȋ?1Fw{sp8x,g5sWpP;!I5py`x)*:f j*HgC< vńa@IZHb)fT#1=?p/TTsa4pI"pJ_PR GyY~nfPY "XRVE*lITXjÑ`5EqYVy#F#aCP6דPN%Ǩ7 SQJ\/9RN[TvàR]w J`kD^%[n;צ&BHT(;zudZEAJ&&y85O8 FA$׭ I,|$(vƕhvvjƴNۏl[0BJA-ȖVޅzQ8i"qp FiT}+v6RȢٚ&Nƀ$F1X)=C04U"(Um{K!hU&wr_X6 08|ﱮ\Z| T`dEC/'(zBB~׿,-3H>#<CaV@M l1W-ZnqHӹ`v9Y6h/!qg`#K퀗:Is-ny;"wîVK*P/N!hzPPk2#w( \Esҕ*@:֟N7H'"-(I[M铦#5Ŵ}nZ71ޣ@*B/4 =njQ,J :yg+''l10}ؒs/WDI{3)_ڧ++k;sF=pSA\ `4 zÕ@bhr+ D mׯ@q o[]ZSH\Ch(iT)?^n ~fy/j'4Tʚ,CM{Tw29Ķ DE@ڸTWѹm>#=H`X|OCK `P5~%BPl+2%{KƬ9Bb|L~[RP9T#H Aa],y8?.. "AL 8n:0Qmv5MؒXOʝ<i{mR?N*׳տ欦 zR R+S=+A<~9T0ZARZ'm.]H>T홑6ϳE莬Ҡ9O-7]ݐ¼5)Oq+4d*¡(~#)YQPOo*/ǫ iZ}RO}д 0LQxHh#[Prd G$\`HK4ĆaFJ۸2\E  _qㄋf v3!@Xm9h}r@ -P2@&TM(od.RV7Qh6-h;fv@?KQy\=::7lU߈بa.wU̬VaB&WK*Z)!5w )}^IZo EҲq0u޽8 , !ݸw'A<+$iy9tQ_Jqqē~30;OJrCԐ@7P#};B=* hOUO {Vxyi+"w#I;o nqr)lnR(÷*.$R2٤bДeQ':5O|tN Sbqil -7Xb-QP+Z~Y ni֗ZFHVPuڬmo,*Ul{㈐ͬYQq' =%.(p9V!Y?~ $5$S 6,>T[K2mɷ)kPEix~;b2; 8ƖB§1D I޽v%;W2TsN7_ dekD:` +M*l}C/^حRG#5+BO*l0P+NNu3RhANiyGxFXTHˬ> PӏZǗ;8&#zh ݸQ'(;dwn5탒-|Ȫ8 ' DUXAX ;K2U!щ]*j&9~}U8ck5(Q IX/C/튪I~5 -RփbY懬Nic7ԸY!A:P 25=)(.NA {M,$G_ JH?,FIJ;q%mD%5CMG5ARKBĒw<1(V?cBGs@[vR4Be4qDz̫ZႽwڿL &%n|O_ JB+2M2iRT)_ tHӸ.)#`?朊ik0Ib,_ҁEj) i%&4#r:mAB }CrBF>ߟJq;$%K^ ZzU.AdW`GUei6  V0Ef>7R0_FZKqk)RKHw7s2' Xom$H.jj:R C{xUЃVJdi,7$mORت3@ie#r홐Rk`( KN8nO}-x'MT } ֍P†KSg>8^U9| mARߎ4c#\iMU}LO'2T14ôyR nO'cXa]ۋl~8ֆ3c4 tlܕ] FQk!61ݝKS$j2xOk 5's#;d2pU`PP`9훸!oO'd.ʪ*G\+Wo-ʹXm;|BiV4PEdXijnw۶>k qWli!N+x@0]RB% ~!+C*v'JHv $`o:-4ѫ83ُ癌I_A\xw w{RF?<ƈoHVK1¤06jRxA!+Y բj(kiVu Inq)!hu~揵58kyǼ U''vatR6z7.g2Ēғr'7  "VG1܊F% ƺxb,I4-LpU닙 Zt3X@HXUc^Ͳ&!d!;Tw.~}`4"2<l  PG_PjpɊ@ӣ\D 9_*XjIݰ Fӕ;bC1T$JW$Pv8^Bl+q©UQ~?L~)e#rS|Uz MxcJ튩KjC$Q*k@g;U SԁB>]d}R>V?v?cz2V17$/jT]#IW"68`8 +>'(h$Z{N7A8R$~kS\UZ 7Bq0iF*)_lUX0|FzcLU@MX{f1Yw|-(XcdOubS">>?ҴuY#܎ppHd1Гᐔw 6McTq]9n%~Ƞ놺[U+I%"ףzw;%2U1;vu)-JQZ%1B{( Zt5jc~˃6,JLIW,}=+!jFN=$k54ح?k2ydS > _[˨) rI߯庒a|#ߡjt$irD~/qTc1pr$[$L=^ UM$:}8*\;1k!*VY8*+Ex}Y4l,k=- 9:*Y[WcRcs" "Bfœ҉ 2sM#C Mc=>x)M_ltŊH>bppWv9U](_ NB`ZzL7~Ұ̜8%ZE亭ge{ "5][gPAR֦_sc7e]-3Jӻ{3]mƥG;SO_n8J#Fz{1MT$-I̐Z nm Bh%|0Zқt̥ؕ}_en8Gb%Xw*hH킊7. =bP$EAH!&E024I_44፹_5 Gł-E%NƝDʜi)ZbirLMKPV5--,SK .qv =2 \ DhrLR%Zl>XHwXYRP mZ3.XB> O*em#N~%$_KL*P(,Te,}+50> }Udb~}"bM:;dBU@S@GޯU_%j,j;- H8oNGn dc,܇٦uΩ.8I?yi #q5+9Mv&#?N>inp`yPDvlgZHH9W@w?e~\z9Qa%P|* *H(ZNUHelqvmu-F]l4qQjGؕ?ipƴY` XUB7^J6D;2-Z3AjqV֜Ljc)'T05RZLX|%hH UWoewiALrƩi}?0|ӓ-*@tZL8Y{=6 P)I 68,ĻA&mac:UG7, X'JƧ:*r9+G$B&Ffȅ}Ϭ~@MZ BDzWzShQR;*&>.#&va^nkC^[R=ॆ_Twbht\V`a؉B%r4>ǥ LKZ 7pRʱz/,;,ijP#~ag$ބFCRz I=?S'o=1J*{;Q#7%HcOCCWg$ed~ʪ9fcm6󭴋hI {̥*%/ET~{O?km.IOEC3+.ß਴经?EI?kqɉ$,'94e8D6j"#dO~>iɞԢH' EzPW,l ޶vd.4DQ ?t}Ϗ\Nwf߱c12]!];C%1/P7Md,QOJGcŚJ jmW5SPr朏UQ@Das aVĎNIZ*/6 TM17~Ҫ-Hb{=HA'1U>WҠ"~H.e +"8{￶\R ­:G 7F3"*ٰH[*FMi uȅU;T?dUŽ'QrTPL=AiO|z4I44W'd )NȁiTc39tRE,kHUV,@j,84}"e((W$>ҬvRSP<{;7UhE@E{e4o%&fȕw$W,1qk8^ R=2|CN"(}1N=A폷f4jI=Dm!h(1Aݥz >~'o \.8+yBJJp/$rUy(ۤTuxCc#mԮ D4ȭZBC'V\<CܴDYZ;dktR"S#c _| JUoBƔN;0;+}VP;0t:A+ vi3]棍 .A9Th2ã_u(ڤ_. ˎQ:Tua h'e{te*Y9S>+?/,ՔW,i~kq9>[odG=gS҈>s޴ȼEƟ$E;` C,āvB~&|*qEO}CDe,7=ZJJL@vCz0p+>$qsHeO# '&v,u6?/5\Gwɗm'Z|,zpoYYQNChiqV݇Ba,]Fi6q \岍&b$yrRI~ TשLIKY݁0?3m%z s8埃-@odJe[,d)}f(V Ȕ.I =Vޛ0q%*=Qvip6ȕЄEU]:倎r=Z+ z//dIu!GRo.({d65)ݰx| $f"_cyim~`^U>#~-Cր'h-g\Y^02ce2ZORyP) M|:IW~y&])Pf^(nʝdAҌo9SIP~c/{XpGW Tra`I ea33*Tm_Ǩc ZҔ,X| _ŕ%eD@;К{d7m MI`j# !,AvǍ_Lj/M?<Íy.H[c/yHю ~WH!b%$ _r\<5 o%Q@Y#CDy|^$ʬ*?r?gķ8=I26Ď~:l@YG­;4bdYvzM!lu23Wά[ ;&2p?ihN$QV *L ^GӔ9))*7 a;S@(yG%˧dY9p ~Jh|I %T(7cGQX2kwE*Jb8 UM:\$R6@E0$!+"HTqvXf1j>6@, 0š!IH܏[r%o.(#srNROҝys[Cml]֕F#VsRW6o z͕1u 8Hcy(OEG,*^,KI="("L7o)Ƚj>M^+ A|`Ȝ,|D(#$Fz<|q$†Foeb$'XNvwq]-20+PPo͸gYWE ָ\vm*sb@7Z 2U;S|?dөwbEk]=a h6# JބTcf44ƙYY&NHw8{B#K.$0d"?M=jr}jkunZv9xN-ҘH5 n +ǿe5BBW@ Nt! Jko QXF6ndH=;}̽3O ?]dtd%{Yo/+ωȎ <Q˳= ҆r106l`U0E ,u<̉co)VpTƢC ߒIUjMA +R᭟PF&)V uƲZb퉰QQRi1iLU]$=dއ*%>wn[cPPG @qT,Z W(*g`S0jW*CEˆ4*1J'*Ҕ}P$UTp}銩`GO1/^UV n=)jcMUHA@銅늡B k9T|Ui>> Y{SQ+U+e[p% FW\J)¿\DyuۡY=dnO@?#~Kĥq@Ѷu4GNJ5~]J쑶 Y2G*q݉< Lm]YxO8r-%dUZ #;dcf3d޸hrJXWw)+']rN&c2I '%;TmA1݇'5.HK%TfI}PyבFU1Ď;KIiMD!cJД'c5G*8v&B1.0RPaZQ*^T+ZW9q3F4#zHm^[k?W{IH"t@b~2s?gm% Qi@u g%fkjBMQ7P[O" O(?5d'g\񴃚l7Ĭ}k\gVM$S?k ݍPdNi JH>m0$m!d#췊ױou2]Ƭ^h7e_##MkKʅҒ!ũu;0dɸ3Aurڬ'4@O|VEһ6;8pGd},ZT`"|3]g"կL`*.IC[J5 +R?@ f?Y*;#bXYPpgz) Qh X @JjO}0^!B=Fc=O$Wq솵4\T RR>_oKNC"kOJfNȘӓ\^->P 22'8DS; (#{vOY:)P7Y0 Շt,H]4jOԹ=S%? ?iJuY6f4u)\%N&\"J7V@JЊE_o9rCnӫ9uk {j?ݧ%^ʹ%)<NvdU y3^ v5;8xkJ cj0,]$x  U<\C DSQQr/V1 ,jPTdɾO!j3Up9pߨogNlCPRzgESѕ,[56P5ISq ΓJ$)UO٠I|X<-peSo#}ﳮoD<ḇY6jO_ n.kҭӪ#LysIGzp<%9o1WGp3}G<,ϓvaPW?9o>|kͩp[V(6bw/p"ԃSrr䀺#Kƽbbx~?i !Hz!E*rAɁܯPFMQ#ѕb#\kzN/OWY$tk=)*6DQ^mƣ4|W yldjaSP)6RڣFHՈH* C_' 3t٧z@fap%˱B̩Aɿɜ J說*KՕo7c[+[x?dB.^2yR[$Z]kuO;uU~'v|:c ql&Sђjw$x.湝wޕśfݘAlT؜Se(Y~~+nU C!H'Њl%\ֹ!~v3L*7tpS aGPvz-#Ǝ /K'ɕ~ w=^$1f?dIb;a"- w+(s&pe\He17^NlGd,j FbN=Gf¶c!*Iezaq 1GGf$)CNo3DoID4D3JXh7>e2^ r%)@?l1WJh\D%#ƃjZv۝TVS0#aڦǗ|U$K>cN=H+VlU&w4d"&cJ]dcmWS2Vi-a9P|϶"Å-oq|rJĭmB<yMv]7sZ G_ eΉPI>ffRÑO `EF;\r us\桢ޘ8.a$|`T8 !J, EEA֕hqVƃa丙SkHx{x^Em6xL:)1*&Y#7RVd죦VK(=ѢQ'/\F""&EF6ؖalVR\T8\*/#[ 6՝,Ec'} P<74)l)gs%FpRY$8G1 "?/c!lmz4j +¼𯏅rt0ޘ;T<-!aƝr[8Q6m(%^,zTWX9RP,ޝuj}EʅCO[]9*^ ň5n[}Yءԓx`!Airmv IA q2Wǒ<1|Ӣꗐ6W@TG./λe6 `(޾+ FxAyR7VOH n 0]a }Qzx"Ww!IU^''~ .^!ٺS,N؆`42;cZ>.]~.W7F9N:ң}k"wP)v,>+ӮbfT u Ё>yt@AQ5fwHiŏ!d8dՓ1.lʌB/4b#xʁƍھ& WS$dpV7ZzRk :Qdar|2jd (P:䁢Ɛ`q&!J "qz(_Ăz31yP/rޟVX}Gd$.|hּ֢1S™)h$o4; 4t⛨Tޕ }Ҡ |) I6+Ul!E*VCʍ1e\Vi-.J3/LzB&waֽ}PM,ix<.}Ȧ׫Oo 4Ep*8I]q՚$LOIO@Ymo ?a@h 5-"8!V ĀTF՜m1EMA.aPT0eOrZPnoBLқ%I}B yI++^^>q*uu RZFc$̿q;OQ^)VQ\ qC,Qi 3oX4og)'NmOl#0CC0gN'DdϦFQaQ-hw۹]NdyEWm^qYt_@UTmFfoUp,@X>FSԟՅWv$ fR(qnMȜ4`1lQF5QR)p(Z:Rr#e ;ԏKD W0n"%B|A~0^فҞ/p;C2ML$wcbRJ÷aݲ%V;9#e &@ɀ$(h]_ˊoǚ]mC|r\{-[-EI/6cػ],{B_9O:xCn^S :YSJF\k$BTT-A5O⨆lW{H4«ϡcGQ6poJZQޛPbSҸBHc0*:ت£vQN]{W$xqĘ|*/8)Kn ^G lMq{5`H-cH}_6~ iO+04b@Eϯ9?G8m;1͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tlkO.V_֗UJ_JՑsj/i@Ltuj_ՖLUk%hܩ0vUԔPXtr*Xkһeқ*>TU|̶hH¬u4@kNz's R(£윋#|C܍vLȚ$QL3*j1q2Usj1Yֵ4=0DQ[s:LA Cɻ a]KQxd8!P:S&ҤU if+%v^8r)NGޘ- P7*#+/MLj[5cwN g!8)dpW!/eMpD,Ms55rE;ޫ-ӓ,yf %fe-W~KmFY96B B!*:$h=Id 4(k0g,iO5S[8i"1$U9#K5i)3- 8BWV`eG n%F"ũ44¦!u|-_VO0--GHM78IAF7?yu ' 6RT|8i]M65Y$cF+4^k~$5d`bJ;m 뫏[1@ fx/U xkɚFYHU(>~}xӁnjxovJ{<&:U.Pr!PJMQfBLM.w8Ӱ7nLOa]GJÀ8DAKbz 6 uۯlBac@k߷уր=pU_eSN'%ߤȎuʹ*VRJG46B狌_'!\DĒH=|:ct FR)$K}}&nE\D)ثXcwxeRRVJV}.xuƛ*s+܃;YrDMR "KS ԊY Bnv%s+XsO_n=8'3 8S|,i/H/8'V5ɓC]JmǬI+߽1H KTbFpq+RO"@"Tb%*:rr@8mi7WYG1"|7IF1t#'.^yjǨ1ڳ0AErtIS - f QCJ[j6/2UjP"[xn+Qβ|JiCPZThݏA~P!GAPm|^Mm@}"Ov5IN+C3*]zፘ[;(f;o\Y)FOtnVeSrĆf(RQ*FirN4 ]p"kŖ)ٚZX񈏇ilbuIk2(N3K< dd0A !'~,{s\o8Us# Z/$FITWݤ1pYi}xYF3}1·.[s[T^CzYIer+Z؇2I@ B0kvCSH9R$O5YQ0mT쇮U%.k@y:rJ¦2DaVdmBbՈ^|v-ez4by2bZ)Z7qOϮ%c ȱƤ)$H`+gVET%{_˃l]{b{hoۮ`ą VY[ ^x-I #784HV=M`q5CaV3.\tՉMW$9 N=dQiܛ% h0JV40Pm2I]A~!cA'+{|KjB|A6erʢufYؖ wrU U=AdNtcJ{ 5GG?n%d "'<ڼXl*oP !i#"CU0?5O/iI6'p6]mrB{淑= MZ]*)q! SqG@O|3 90mSİ%dx`l%P;wGZQ_rb7lL;mtz˸_VeNFUyM;9GZQM۠' $]_ chgVV=%DV3q RdYhȡؓ]iC>u&um-Fx_D]ӞG6c$ U$ aIl'xo U#wf0Z[UM}dSԡUhFq1J~]8*@{Uew?0rD{V+~AJҴ>6Mnl=II'v]@?+H:c팹L㑒ruDP J`xq>4G놈TW335wnP*2)k^ t):g&I 4"猷q`H&{wu^-w=GVR& pOcX׏F)o1N7jwR1&n#qJHt@`CnƔ.z7$Lnn>xQ&z+˒ILe1}ed01ɿ6-#mjD:luC~|Y+kk"ẌhIOI)vmy!ByE;U{`Sة0fܑ(9"@upj!KWq/ĬɎE A wRZf=XűNH TUQ'&Jl +rٷz-5]ʃJnvL bFZG#ߑ>56sU?vbT?iA_#KʹQ6j7,Nm/cO[s4E8zbx?oXsNJ靶.;վrFu6ynA:7Ԓ)~/u91k$lEZۉNLAJS8[ |1PM}RID8)j!,UT'Ɲ~,%%}kD$@T&dw:jjT`jtv)>$Ay t59lM~A'fYeeN <\)nH5ΕkP皑xN["DVm~Qļ?jSMO$3:rQ@_oeH+{}`+gI pF@"^ߍw'=dp\[-Ph !F'f-j 9;.AR2XB;ȫ Tl~=y.BU$XtLU0@"1~~2h8Cr405ĦyOv8֞4G.֥VV7 I]~K0=/L$uZZOltD7*ը?JdUZh:@0;XڱwURHnxereUArH7]ڃ0۫qqSՕcCOfy_$ +EQKQYPyΐo4dGUicڣfĦRĀ W6-hV6q}ۖ/ņuSŝvB*O ąpY *$#PjvVW? <̼s= `~]hO@(z~ H-wo=w<_lh7XѾ A*TU@jAqTJRHݗӦ[Rw׾S(b>,UtRĆznv8&aM?_:z!I{w1Dߧ|U :]@#6+Q;Fr?Es̬݋/~Tm ":s$sfӲثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t[9?qܹYZ_{R6>~3!Y9M6WZm8QZFezU!#p9l'bĞGb6n@ilՀaP@Ooֽr@H 9d!=at\ bit/CWQsgzgy !2LEAw̘Ʒse2ǚ$PQ(iA >I&V?w\'NjEwJuɸ_Sbq#9O=v ]_>2Vѫtۆֽ4Ub W"/}EdQU;abڰ#`~D\xM_%ýW R5Y098(I29Ιz&HJ?B~K5wC%ǦBШ܍|K_SMpR\4HIu R[I'ܾtl@Z-5 j>zՍmTNK>݈'~:#E-̰߲W7Xje 8(^&7/OLk]8ot[ l1&0CfjZ?Ēk,c5)T3Fy5?[jȊ٫42D#elVLV|Qj;m_}$#Ja&RSaKchHeua^k7t>$lѓ'eqsn)*)G?a6q-bk(<>a-ErLmVYh 1ܐ?,_꺞=a/{ٳP8J28 ,ēl@dSM vkXXԟ!*qG\Hf4n(A#4D܎HpP)"rUzx 6>%RY6[#.JMsFiZ$tU1+ 6&8=eiGC!1 'HP*kab=ˉP}I~%ojFƇ|{+2#Ā4N 6 #YcskBN~#ޝzmrԘ+0]ȒB@-B~}0.ѢI喟4]*@v#cPIdT! [pk+BKV w#WY7 yH Uޥ0* S޿F[n+ub"Lڕ@܁WfƦ-ej7ʛ҃ )U"5$r;ouxK3IW"GC A=rz8j*tr$GP֊b_˶KS75N` -%FH$*Ǔ%-Ph}`>Zvtdq$mg8΀i&ZR+x.xPdUj*zut>[ JGK 4ZU9Y y1&{RYIA&ud\\4b =BTHXL\?k%W惺]/5yc[фH䈐̪6VZ|>iaE@OU[%}434>]U> t2S.8Gȳţ 1(;7Ҳ҆+Hۙ)Q[|jȸS..\! Y89י(?g%^Z#7F/ Zefٽ5貐mFkP/Ii_ӿFřF:X #eT+0=so6|.Sks{vʶ%2a[*VqIgE+uhZ7J)lV4 oƽ* K)` ~׎(:5:9Aې¡H']6.ޜCx%+(s+>; 9rZX^ kGq;bprtiϛHTP,FI6 WF$ K5@T#7?,5ޡFt&?Jr=OlxN{Ԅܱ\h[&H@:T!|X}J:,bK 8TۯM<,чqGX}z7|=F\qC41iɀKFL+gC_<0M6IJ '[TgJ-0G)&# >|$"67!ʯNɓҜN_/1BbIA}2ƩȀPN _ekla[n}ӗG j|> x%*s1_EPNIiб=aFQF>: $gU_y ^"L(;rr WU (>3^I'd SYJbW8r/!xw}t0` XQZ҃XEtj7P0(iSH)"$kO4WPۇ_ltP9*A5mEqC#ɱ^ abLyyq\5nL+ G[_ ?'fH!6?koc/>$ ܞ0BmbJ ?"f!H?^j.La`;vA кveZ*|1'"duZw9HkL=b֘*W|4ĩ1gOqL8HY#+k0AJ @ƍ1j) qGVw1 IJ퐐ieF8 "B|FWd$Bn cnYCU<9ԝ2 HȮ E68, oSöVBK`(F~Kq@Z ]v,~=~mt tky+r ,ONLjpݲ;Y%¯ĭQ`x?Xf+"UxSHc"ߗ=k۫$JXЃ$\\bwY,%TR:ҟH-ROHB'.&-Un%E'nclo0-ﭵ[jWRVq O` <,ѽV0/'oN+7[S҇cR.$z|aLrܐU\@wD]D)冃_>?b&8Q!ACv$P ~ 7Isk)"Z> }I' Tz?>[۹$T+уoL5lWva~]x~*8$pj1&jK!X+N6.Y_iy,Se dnGr, ;5ˈ%jQ\[iy&2)D>ʷ11a{ c:foѷ^qb׋e14)T)>w]iT, >H;Rc(Am!RCzq&ZT\2Pc|27WȪP T z7 UFx8=N#WČU 2zfUθ@MYuUq4$xx}M*nO"ݱU`l޽1Wr #o*FXץW{zv*ktQ#2Dz3+[gQPT©e&Jõ2G/ 6ej_OPR(JtI)!A̠?g\H`7q8ANjEFDYuo+-}xDkPМ_cnPWDSJX NH?bfE@xd?dۭ[8mkHcp@TSre҃ C IQ/*5o LUQYU}^_~B@ڛyqd^??-C )x o?̓[*ZufKOOIpUΞДd \5t0Zji5L }9НOi5Gim/J[ccnhkN{ESB?''<%9 `+7S Qڅƣm02 ag"rLaeU xt;4ٯ}k}Y#'<@9s+H߯7")+6Ea@$u&WBzb\9QOMwܓֲ&}㕒mw!Z"jhX1Q,؃lHmʮTmTR:NIR .Gf?CfDW4HUSSzaȹXlb z: P CMcotEQ$ y=2nw0wڤp%loeQ2Nd;vqEx倂&<@B<@ZL|,XxVoZǹy >J$]lA>$[f $=iK(U9=d f3;K#O}GUeic5nz %;nB)Ezc"&jֽ;'d 2q`  ZV)Q=olA$sP;-6.]Kg1WwUJIE7Al\K~-VfnOD4XZdFV,ȤğL)(e"@TTİK%c? B!u 9]U%Q}"\U,~1Z/#|<\= Q5E,-D1 w6\ 3 2<(9A- ޺$JrAUi|LAI?M9Xd4^XLhOs/1]0wfȭ<7&,#'WT`w#~B{{oŏW* بGJڿɘ `")B)+in.װ4Y Jo'U'%kQRN1ֶAlH^sM5=ǤZW [HYITP['LZROVU }h~X.#:mFb :Be {c! PqE7D5Y@㸦ۣdi֠TZK#J)?"a)Z$ u'$SZ TW(Q C(Ffo対%&>qA nʄaH# ySǶ4W|q@=v,+a41v~)w!`7j + "dA*cv;ҜYDh\v)$EURNҧqkyO\ATPJO%kp澫u$(l̊i/@ w5'P!=}Jشh^BK0#LsrCآbImNiaӈ{"6_Z #U0ܩfj'BdhhE>{jK017s_ՈtBE Tt'ƽSzl盍04i?fNќ5+QSdʁʄadK'2KW ؆%T#~D[ޛBZ^?m,:@t Fx_8_[-, b-i=_dH *х#xrX_ia uΧOMN4t4D{G?qO mqI&;-5 ؚ@[\>ĨUn2S? K0" UN'(8ĊX>_gVM*12c9h Rhciȼ(Aq ą DH ѭsO lܥV ? Q% }09mr$),h dbJ[Rm7'=QJ fNӶ-yJ$`P,U>iڮzӧ /Vdh13  m,zDVV c#!;)2o6n& z}kɩѭb=-jh~1Q[vV-͈n݆%q3jje~B 8y$\"P|e,e=HژӥcOm_ ІF-{o*?9>#'ɶ=LkV$%]3¬U@ZCV}]CnK['ȯlɝ҅If_eb)Z(p~CߋQ(v8JŴcJ纪 ?wn2vM,&jw# b$3ԝ6AS,]ǩU@:SbNhmE)=CU#@\d.J!^<AN@VF1e!hI;ղ 6U}0K'6kFTػ "# K+Fol٨5Eh|\,Hi1:~d9nT `+ծЊN$H7r I|w3%h H zȔ`)A>4={+v4r%īOtM2KxY3J^yp+q`*v RFq*eBg v7uSˑoUص8e;}'eXlf%iR*¸INLX^Z?yz`W*@U(=.Jan {ghRD\:1lIݮpjhb1HxMa%ƥ%r8YT+׏K̭/Xňn&cd>io. +CRg8و2@Xt<`w<vcJȆwyr¿3ƼmK h4+֖P\ٔOgY ڝytbz!l ʪ>qm)ŻVpd~iYm^>Dq;ǘdM*~BԖV.nF1@U yZ ؏*ܬJ-j}!f5;r}6@0 nA2Ke7qnas݋`cAQZ#`7iJ#5$XڑN ?hIs8`uR2,DQԊ+ӵ2I4yz ;;$bzZ0nf'y)!*O*ܛ;% HĻlnj.aV`qn[?9mgd&'M>ps瓁yI!kh5 .>)Gj~[栖 ޓ7J2:|\We,tFֽFv3*~M8jLc@M 8Acf qH( +<~"H kzPy0Fro7_U@NUt3Aknj3.Fxaf2oDV[놝ݔBV@%nA?<+tF}4HI XpF#>p*ADvbjnj`i\3L$^M'N*/Olfu7>; 5 Ri*\Tb7k^'@g'r fB88i|9z+;uB@Ȣ$ X7'v`'ܗ۶ @ FE{㡗Ґj\AC"7,6ɏ15`\OR\ֈe sPv#N'+ P,Cq+3-knĵz=fT8.O%o4@V |;gX6җzE*=)֦>MCӍ0`8dJyTRL΀zan;¨oS 3l~-$ިHaQ;DYNLm؝4p7cՏQ7Gyq#,q1 UzT,-H"lz/2 5\ q;Lx$UAc{eZSƎ_!+Ѓ⬜FAE8b eǸ(W*eUC>" W QרÌ1dUjzSjyef_t_8~8hq S$sӲثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊?*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tt~y?qܹYZ_{u4u67N&v *1~BV^5 OsP֣oIo|S[- ڹ`Pw&ZUM$ \^ثf4~zEOBלw;w8\ "E#P^ 틣STUj<&au`痴qcۚccJ,(b]vA^JjP %^$m{viG_Z(r+.;ѨjvÝ j3q,(9379P19)e#'W-VcLk;W495cD!)LphLK#%M7 PϊǙ[mS=>,V[2][5-|I]]xꞁ4V!@a@ (O,y'>+ف% n"u5F6 o$l>puj> hިQ#*BA$wԎqƨX#~ҳb@Ÿ9P/xUɈKt릒{ "'F$őo4aѳdn{ҽfshQJY4M&iN_:.ԅ`HQvs-A l65!WڵĪ= 1ͤb' Ž*OBn爒7%h2d1%-ECt *ֽ[_+ƙXKJ\6 CRceJP}$P0ù;d҃J`!|T68iS_cƕ=? $uWQ.KYHp щn\XE*zer.@f1,oʮݤ`"l]2B Fqȍh4 S-*4,& !hUmx.mDD7c]4_=IX$L2GɈB*ǘ=| rytv?pZ-wMMyDfx`'j 9<[ipV5eDV0 4#lPd,eONND0*;p2 o-CS%ŕ.kxEfpEEh~xv=!$j? AߎLՓ 6z i2r÷P)pgBZ5)< ;e`'kx'vp+K$TS]`S<\ש` 5b{'=?N%t x !h~<7CjG=\B3b]WoL,ҭB~ ~vɟ"YV` WmSM & Ǩ_/iLRT@=4Ln9E( 9E՛9 &H,vs:0--c$I <[¿.Ldf{dYRt:n1OX(AFO$ӓ6%*!,[n[ù@E۶- @! z`;7;^G8T!Ө=>FPj.Gd4Hc&(>yhi͓:g/3mS7ED4OJG9 y3! 9l=җ"aĞGsY[XL:u#K!,juc6$GP=p3:T~vyDoH•ӷbi&uŨ+mZ)\e22pNE濴cSqhXTZM@Y [8Wa!B-+_+lX>ط#Zaǫ ^G" x\pj8vs4䁾cOX,DBkmF.6c"SZE#pO+,ξq-]5>bU7'b7 'Eګ|~M<)qZ(*|q۪+*܍MSJ0H.權iͷ#Ҵ&  (˗&_l4ܳ 5 iJWo%gI eF]'h; Oa#Ao.c|i].P%?\:(3ĄʔdKF8S4 5_|drLd9~7YZԦ6"&4C}d9:6;)'zpWDZ!Nr"n] ?k4,nɉ~Qݐn@ (lx^LOl ত=E^rI4Oׁ#iYA7xt4;xӦF,0U c+,ǣda)RJrc4*VH7A[º{)=D˒P+ߦmdM$ 4]]`*:E,m"ڇ_ƼĨjԧHh Rr~ ;cWՐZƿ:ao=HF?g+A([76[,悵=)?W1 `YFz[v BTT?gjlJ/w1ODb|Y8@j`ΪZ>b[׌gt.[~,u3{ժ׍v\\#;2mTZ1r(8)R6ơ=)5ݢ% JVER$Os_!Ff$5s(ÓWǵ~yI۾yeC@7j=NoVFK),&I5;+Op O *(kp$mʛ͸IWDޢF8Qs`RS%r@N*Ӡd2K)뛀l=v9-|Z#ul.V5￾r@LR$ZoOXnzJK:vj/8UkV *<m2Rڜ,o o|7+=$C͛9?h<d<*N{H(xL,kF2Go"[Rh-RE V?kTzkCN61[9f=6jW읉>68 팞EFf4*A%:.J<:wT `e zq'ŸvNRUHTrvyzE4 W|G=Fg'%TRo)}r+eSj}S82$zn90mےaGhţe,B)FF5zdlЦg%M.D|Xd 6 6)-CpN34;9]Q:H5@R ;h%`y@@fBUw55?,,艑X=:fh=J_nPyI <+Nob vŤ1ƼILi*ijqZ}8 7}E/Tٓv:9'ӲN?co? e1Վw+eH䐕GRp:bRӨ hU~@sef.KTt6e^3I8257>jai#⨠]iHRJ$׵v L$]zS݉Z@V3Qʧ[VJi(;%@ rAAS $ǻ}ACJ]$f?A@4?0Zڝ((7C T 2yWVVR=H 3r-kZȔi@HnP\vPƻ(̦qjVmr~Y>5(A+y]^WB\]eR}pYiՂGYuBI}`xv$=7Y(dP1]`wd 8 3+$wYe|MoGRy&p$U)cm  1 tV+MV]4$̫' Rxw&<;S2+w T,3=mE/ PeNH*ܿgey.Ui)^Sֿ,ZP퍩qU좕{CmL*G #oa߶*'*~w+8ҥN`UoPJWfjt".D@8SzUWBjc{Uu0$xb޲x5@^DžRy簮S^=\Pre4waN$28P9<E61W+5 Ҁv?PYG9m;+͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t\ wG˕{Rs/ZHE+^҆jJָڣRs mhqUԎS|UdMPq׮*A#[kRA8Yn9r$/;)+HY p{q"~)')K5J*dF W -,fۉZ$lZޒM Rdo A49S -Zӧ/VUܒW"!YBSNM~?plZt"5FMK)JG}b\1\UJҠX@Sэ]74iP!}ilwbe"?^WƸr/͋^uI=FW8^$N!` <2|60ҝYsX""呋S>-W5 RcZcJWeyIwJ ^#&Z,;FRi`qU,jj2Ѿj'YV]tcV"v4뀔eAPh( ynMB/-ЏϪ?8*4;?h'tŌ v [@>Y}1sE.M՜P'L1!XRҀ~Z969(G)+ #q]QzLUhn͂Cjb- af>+pEKլGABV&=,GQc5NbGtϞ?Mn"JQB(8L)O/"f9) ۋ4RPПI,mI[`~Co>LdR9j6m$l/'Fe}(WΜ saxޣ-92^+z20!jd'vsjwi!@5:hLJg_)t'Yhj[۶j3#2q5 ('I4+ㅵvQ׾H1a+tSz1rHNgi$|L፫b1\3Hp+Zn@.[@`Vnh4I)&,bTq ٮܼ@w{ʞQ*mB>]No:lkO݉.H Rl5w0i9`;qKZqBh~d\ezPri9p STBFRIn5s5Sj#fa-cZ[ . m큇6T0|*Qp2HߡY.s]懪k :dK8Ykȧ~ŠqfǨ1 |x"Biʆk-T&R"7 =)ЍmמB1n`jV8BhMjOF=[56PIZ-8%rԲPMS sQQv1 ߡڋs HH+* ){dc@j:Tw2%XZWjm2HD+uoIWV'}9.K@9QGqn$r}Q+fQ9S4noEfKi~PyhFZ qisj哙عc%㪒YH4#$'0-bTI ?ST!o3-KˊZ% BF۳E30;7#<x~8<-=@Jҿf85n,EGyUE>~}t,7!뺭Io?!r].`O՜|@W͝w#c @|E\6dxrrTЏ`?مi` 5+ry. : L: B:YL nV'p+KJ⤐0QG7.;.2dx6kW!Hn,h=VZVʪycdUA=KWDXsa^ZWa^*%,@ˍ\F$)U phޜnha#wo{AGf!۸ՙq摶44ˇZ$uyU%kّY8?8Deq3hB[WST _W~؛E:"Ok^ű( ZtdbMaRRy@ţU D rIS wfRq($ljO=1-&pO"(2' @M]\UC>Z^@ }HWq"Sa5o%|l+_~î/)VkFaӮPa!>Hv=~9p} UZ-F'v^s(R2Q5 i]O*8VU>-OBH~?эH5 U"as"rHh|nœQt*#enDl;{]]:^Q(Yy%cIj}N7)nF*NDz'Ch𥞔 b)˹N I3rvM$ Ć1VClc@ȡ;rm$+>rq6IۈIiф푚Nœv̼촙eB:Ft!:'Q$'55 `@” +/CPF-JH;|" ~3SA^R(y(7޾:bh2Ī;4@FCZIݿUi? $E%jaCB)/ji^ dF&;~V׆h? cN'0cˉAE^pַn*Pz{f5ѮzS'yE[Y4> OV'~ w\0R " Vԑ"[j%(o[`kh ,$Z4: <,#v.>Ī ?F|szKCtȋmYuK;գHɐ-~xR`򘀵b|Yݸ!H|spAb_ca C׷r9h/֧(@$wpzKHnqۈ9PPDc'wǩ$x'e8Q@w:c p@( -$dW<2%ӑ\S*֊iJbC0ny‡~&fXsQ0u`T 8 :5X1؈Wa>ϱV}!MF*B"*kPMw#(>J`!To!OLnGRzdX,7!ڡzbE:TT~B|/t|Fƪcxٮxvy-^䓤M5ĭ9|,f>?(5G6@lrR0^@$z"ZW4qKonJNq(MRT5Z$ߥ*:"-1zWx(wX p1h2~`ߋ' [4&3ՏsO،UiVV0]qR0*Lqߧіbg4p@ڃ;T‰vtŔUz)OFHu>[!'~Q c%w'Xӥ{S4oOs[6v@z펧o{[xlG_ɎGbѲ"pH>S>~cTvC)#<d1RNh)j(V"t]^vQG2ԑ F=@.- M ).@.غ^1+yClhoN#Y3RAR$Ӯ.o}>, rƅd=+5Ղ+҆X*@ϦǫÇĐf2Mmo pY,{2^.woQW?3&0,AdAS_x׿3ŠMS-E켟ꩋT"\bE*mۻ搓_6#dJ|%qĀ_Ll3J+^/Kh8,;;x` Pq]YQ)rI'OC|a,^%ޙY9vbr %G1ju ^Q7S))J_ P!|4~_ JƴT]UȒz@-+Fș;US8zQz;̜Ɲt<-X =H4NE@w)r\ZNtA֭'; &IR8I20Z ig{HeЩ;_dD|'u4T ;Z)WД-)5&wA)jDVm=KfS[\Ni͸4t>p1n@We?̿Lw ܔB5ٻ"j|JtߍY @WH؀G"k|Oݚ'(pTYF{䇻3|$Op1,(MMHrA–CJm᎙`y"ӽ79&TYd3z(;d`B#&!mUP(M7a% dC-RJ)l`q)n4ojN6^W YHI߱ɏ<|.r4zmv8pPhTĎ]lV:lyطi uƮm)QHen,K8Fm=}7[5 8AUc[b#ILy̗VH ћXQ%rplHVJN\QGNay-4FmOYhH ߊԱnL;jVSa F8.]).!u[ةYdOIڟe% D 1UT2Eq\ mr`x;αr&"ݥ$rƜj~;q0spte4} ?E'>IvKU#L%Q@R*IBMO7_o-(dSPU@c=J+PA$}•j!\H+Zԍ^J9'/|KkZ$koM]NIu9\3X8,fF{P=?\5l9,\Mo%5,nvhߔgEF ۭw˒IHq䖕#\djG3F,MTrZP©4+ Ձ&ZH$j>8ʅ+F*68+ yA)&$1FiDNè5+G%HI~w5#f:zaͳ!VS-Wӯݒ v T;P|0| Go &r` 'Viet'ڻˍ(ؐZ=ed @қ~K|帵b$ fj5~/.-_u##|*:n~U2U1u,*RZ#J߫59G?ڄښċ5(N=aXba(r!U&O7k|{wI>һ_]˕`իASI ItVVԯ9#Q![aلF.ay%Ij|>t/eFG Uc1njP]d#=6X/vSV)9c@^?LHAh {v,y#*љ +!('+9)"iv𨽭̒0)  vk:I4K̺SNCsW-B6W6[Yq\#/3 ctL(Eo6-?w5<{md (k>iiD1Jn#Sol gWn啶S$߿fJ+rrf?5;!e:Z}m_bȆ5d8"~fe)Qy((O~4-+#-yj8#$Mw_ol"6KQ!.fj=q&":pRJڋ@%mF&sHZ)4H091+q/(Z̲)/Z Ũ&:Pa斾(4i\ȤP ([ qRc޻RD,=5$ m*wZe*C ƿNpC vOcCJtGh\cn,&f,7d=r)TISV> Rm AhǾ[0<+ p`h]~+HȃJ\ԭ:ᢚJoJew5v 3J1m@z~8LxɕHu'OH_oG!mnI.NK ]oM B Id|?f(?@iyFiݩ`-#I!א<1_U킍"ۿ5:Zi/ !ɛŋ%k*T5 G_\otTy['@Z]s{5g egs/\EVtլ +pH`76 U}A(j?̹p>Mr"iέ#*ڕmd_`hUm_L|%쓌CԳUnc` t v}3jK'mfq;A%j2@wu-Ěns~p"#oVeZ?|iZlԶ!ok~.TSNWfPAԠ5o1/R7%oM SSGDŽ^nӽ0A2̼RNADU\?vdZazhI6Pw;_|@Ӑ~1l+^>7Q1n=(L2I{}8$ (O-~-+NP//!4[Ґ7M19GV|oc̦6o -Lk1N _;), W`٥Vv-#vPjW'&8<ݾe@zؖkgD'q2FH8 AOjǰwݓ O/RK/1>y7YCH|$z9Q[ؑM|5a<҈kSZc8M[$æVWP_5qv瘹!aQJjK lu睊@AO E}!D[Ȳq *?/\y0ހ嵵_-K*Bf'4cAJ *-׏rZ##]v'ʸsW-N2?qT"4v#7儞ez63%xМv:MY-Mt2J?5XT(rm^Ht(Wj7\r^\)Q$zSDA@曓ω?ho㉪jJ!s$p=2@h6a@TO _h+W4;o}DŸ zew VO4bz}qMKC dҔ,춧CJ<=!IG01sN̅@A5m בǘ*9;-IQ3#@"C 4 bkOlkl!ڤ)`@ w{6 "v6$Lyq۫@(dVP(bǡMԪ_p\5plj|f>!³S#97วa1Y>&zW1RmS(ASK[4ulKxK\mBqOFYi7A"Ujw&Fp3J(1UvhǮ(S\U Nþ(ztP=*LZ8¹ Iz[Ň+O5kA$z4 2jЮũUyF?%~2$^%*9TTvj`;=XG?g}1az\Ĵ(A"gc˙e|qbYኲ XbY]I-rekzv +T_+%)b7GgR*(AZuo9<%){RGs/WfLEi>sKrk\V5b+߶l'͑c 5R&'x)ܸP b]\9lDU݀Ǿ@p ?Cƻ TfM1cY`<4!I ^DVENجeM*?"R}Fom!jj`&x r6Vގ7v&n(R<~ՁI+_`-4B68"$0LdWodVCnHBA_4J+Ƅx"S, 8 ~.=0J#(X݅1RMȋ,eBRd}'mW Vp}-L4y!+#F#봑ic85LSA|BOO' D\,[4ECP0Z#;QA`];7j؀z5D̕{|Ņۊ ,8GlY߸U>UmFA6ɘz%Ie޽Člҩ M*+^b$ :ʎXrm+B䜯ߨ#$VA!;K$@2JW@1E/#g4f?h4PT-;{oР6\i,s3*QU!W?OF)-ijXƑ\(z@9)w?mӷ!Yoң-@R7+^鸷-DwZ 8N5`✹Zc94\T$Ot̖b")q,'b0WXD1 T_ג%qF nNqm@};-y4UENSV;m2tDFU4 Yq#V9L(kRv̝LnʲCFe&6e܍zYW%B;a6fl؟ ")L(Am [pufM/jnir#FZ+cwU @i[ ۗIyBqIC_+h!R޳_,Mb8׈r@a_l8I!@ԯ bE4NiN1.^kmYA8<(S}ӮeΆs<29>A)& =|+ SzBf-!cotTY#|dӉb^nǶW$\$4^,l;)snn*TnGa3%J5?Xq{o^GzdJmFH?}E?dxb60zA*Q[+P&|(z -~r! ƜG)H_>!z9"E@\P(+Ch"Tާ!";;0٥;I|Xo7U1@<M^oL3tar` 3n3v,+dnntŎK@ۋI`Ix; FQBKZQj98${t~D%W匿gKK̷%ZM{\ymm$+-60xX>{Sjԡ2q#NܾR@_5W,%#-Z٪y|8E²JP!A#bfq+_rO~ʤ" e ;`Hvw,T/m7O'"jp9.7IǪ鶿\4pRPlpuDY-rdO ?dD/r\i-g̦.lʿcԧ7,jX;R~[l?&)U Uden1}"ŒHs]fMldvK}\Ī#TҲk[i*oMmm*BҕX܋~6[I4K+G> ~ˣp)u ]9Viؕ G#c2T")G;3sJ-T\-?|ǧjePvOu[3&2NRc'kIk[}9P 0}Ţ*)Qٚbip$1nZ;pIOC/knvIK]Ɉ^L\U Vr*?͉)*t_4)faCPk_Z<4~!Z u+nQ;#=lp>&!'ڂ M3GC>3O|9~Ӷ\zZ5-n!oZ QR?gg&F1|?HuyIt_iVE;QIZ #@=2ܪe.+VzPUAe h"N>U#kF|dL~ƽjs;;Q|%]X)]Qa똄 (fhQ%nyP|lOq-YBbF(S6(W[@cL. 69 Xm!*Vz RFN>A Es0H+@~}[ R96%5 GLRY_P8 T.eU$) F\Yz]13#Lzf1]J:7*vfY40oBs q&4Elmo9zCϘ45!eu::.~RpJy ,PFu52dj69QX,9Mr/FoaL\6FH-5q45S"Ҋa+U-us=Q#vK}8]K8sBb %tB}zu5a"zcml+( r?vM jhl: ]Ղ֬h)QIYKPx !SDV{+ 8RbWpv')Tr]T '^!N;t2vCוj2$%r:n&Sw")Kf$ T@DC].rA.~>'5RE5Yבr޵۾=U#PבQJ+q)ͼhDUT`oljn5RVz ֍eP~k RCaJ ٹb_dJ4 4C(/4*GJwW7t=FuQpK^g+n-4%}q^OB~ǁS|4NLUYd߶*HRJTjG}OHNX3k`50GY- meuLǫ .gY+UixBƧo'iX$j qa?km":5<2<]K7׮ءx̱\Spd/;z=NS*6ߛM6FBg<,FF.r6@Ges^V&6逧])[*ӒDS"u<leʓ#`\ H@ sN,v䀯N5[l2\Cj*L:ɡ˜Li- W-UyR@(&w@[ MEUTW)Ch+0ZƝwk[{c]37h@cǚT-j6y#|cW2Q#R#?<WSAH]W@G#ZKTdf*  `!q!QgwT2CtRDHaH|;6M5(l iAQ@,=42*h6?tٲsQHQ䨧хr\#eN6\RKe>|11U|_PPCČi K^**)TWp8 u&OYPHꤚUCb.l4$7 [2"T?گ(UIr+PU9/$3̔TVrBVYqs 56 eaȕEB|f >oӧQ4['|En* ?fy Ai{y dI r7YuC$ma1Qprd2;QX̒:ZP )HJ_l4%z=<%lTH)9=1+UQ/ƼM\hǡ> Hݐ1߶[lIyΈ;~d sUbUQ'GQ\iC 4c sE9R@Jϊ$So1hWs9JBX #k6N6 8z}h!_oCJOs R)gq:5á|8|>9)l-ɷQC犭}X"dԠv/$TJlI$&ʳ׋( vˀuSjo3J3 gݍbDJSu Ӯ!͢v,CuN7JHvH~FF /L}|P5hM:im3"NeEZ}Xª؀7…RhvsHAus k\5sEII`Ks华Ue0R%PJԑvV0oJxSsc_ sXU6R>su-…;pPǮݰ+h^'r{k_ԯ#N|1"Eq(o܉ni.AǠK-2[T=&H[1\dޞ96vY3| (Oϯ5 vxsBzPMjkOwOt;[[0LT + ~ҵlÚ<3wBYȦJ\{tqO|qUD5($67qhxFj;N4;bb\H WA}y \ ?lglsC44闠.r/I3ENFN ԤI-);AÇ̼[+ COXvd|?\E^HDRHܿVKI`y'0k:e*a!buWv SɔȧivM?h+w\*Pi#;mxgqbX#>dLV$E .*0~7?@ ng!~fa3Lq30U=0&QQEdm/wQ6䝋^,Z@-uXFoQVgBߙс%j* ktR> X4z&eXOw4D|qIҍWwzS{J`=k;qz} dz 7|F#}i$j?֮) kjDuG]cMD^YL4YeI6 Ӂoe沍roaY vTۛSOuҰPIngD@'oHGaE'6hWĎ(U`wyfiL(1,z[Wpa&c^zy_'sa,{dĿҠt>̏*H=%;Gf ø/ ,_M@ȕ a!.?<=Y$N0g[&4qFpH QOk@% 阱^H )>v#18׿]֠AiRNpFŴBZFgl4DT4y/Ux5*<Z4N2 ň!;z*MPkWn9E)Z 6,f%5$W̼snf E&^;> 1FK5kLS㕫sK ~x) VC1 ٸR:3  ?,,LE%Aܜݻ1FHc:FI 4OfY8 J(<+MV 1dQ(kL-MgP힇 \-(v :͸^E݉$nX?N'm*G'9Lj=r-RxT֤`.Y!]r2 P Ƕu-1rYqxsᏧasճH9r.5?O\Fħ@Ҡdio/dP6P8gZO߳:lOp30O^_g]AĞkV"p#+N$xTFj]o)BkM:c8TX?ea?o,.QO.]VpM1# UxՏEsZSX9)(>̨{\9Q 87H>.5D} Lsޟ u5ĦDU2.2ҍP'r7*!I@DzL}:<߻PA|Jaq2Ic:;E/H1'҂8שez olc`CNO2zA{"(@CC޹4o 8SҘuVӐ$LXFY\9@|%ƞ1;$/C S7),@;1?MGm7u*kAN6f<|%AzF冈γOwH8֘,vlIU a#)h\RāنbΛ~ZM8VS)d%³Sī|Z2 e@2trĵ٘wRÉ`GJdAa5X\ȄH(A܆%a$?o]gD ’H%k<"mo\ /=27uhЖQIЏ|y|p`LV>9mQ6<oi*Ax̬?,|`^ˬ (ăQQه努֧폌TPT.zt>Ǹcۜ !-{#V U@? _oh5ne&ie攉eJ`~߆ى9}h)G*(_ʹ| yE:1OtZfχxL 'Z!( x Kqb@* x5;6bҐwԗңtYvʙgzȶx'uv@)NJK ٍ|q 1NFvʉm eQZ2+wppsWXwP[ݚek ̮z^NGnLڿ,0iWxh5퍆Z+U6us=*P;`KpyYMVwy!JC"R%ؓM#)doE|%QhBaBH>X i@_4jAA_|Q /h$zxj6JM,?x|oPEjGdV5idD3E&{dLܳ'f؞xdBOA>k9V1vxPɨ TFv95OJ"T#Eis.:ֳnʢ~p'qbAT*9)twCCI(9g_nhfx’XqDً7l6̠J_2aGSe>eq,I(dsT{87]/&[gvi *3,ލCRv;f ͨ%ą#,߅5{bRFb(Mzq0\{3鐲bJ@l/!U1Pǒ ^䢂:IGA+\L[UOC%'olRv4x)io2rRyLɹ& iԞ` ']O8:Wm`׈7lsD8crOK2h:m> L'١#?DlUGS ;o {gi@*vB!-zm5mA^FahAe⣩ScX7E RFV܀OǾRKn.!ICF`uñ''5!uϦFRh=;, jnߵ9<{vP"6K5yC+r*峸 ȕ?c`B $+oqt)s1.P|KSؤծORv'ãAAfO9~L~WyXךeU:OFhFIRZ_ӳHllK1Ga0 7_'/ ͧܥԊ7Dئ<$ ހAp4q*)ބi*ВC 15{u$֒.Ƈ`ND d#m^pߦY<vmw#Žq2ҁE@^Ĝڶ ivmZi#eLRA<@o++~#N>`5Mgbg (+_ls "#bO2s$ w8aib-/,y@&"݅ vdؙhZ0+呋˜$ lo)7^<~TG7Ȗ#nc־$;PĎT|j}:GzQ܍+6~ҘX^B ߮DW SĚ($Ah;XPs]慭(,zc  oqBWOA JILg*\2`¼%Ȓ:zұ*I ;

f2~\bAߥG|IU2œFX կ ~<\J?M0V#|,WFl|za2Bh: IPr"ɮq4B2e 6ߗ9iUZeIQ]unEr*bXmWfmD$/VE1" R'g`e* C߲k1{TV).`dF9vݔ?ohrDhHI][|_.n=7O%FSE+H/v(T|2po>JyM<NE\OZ2"GD3,A@^[r[-җh)_gcU9!D2 UAN*k&@&lڑ;]>G _bIgAU&d]X!ѭDK @V;gbۯlymȩg')…:V6^8sGZǮŒI SPܿo~ZKJgz+7}8(:ٌ%G'EGQO9y%0jO6V TaJjk$XQAr Q'C@O9pb|+<0!P@ Η/lNc( u4sFmQAE)oJ~}hߵCIʲU`"9~K-9sonvml%4Vu"2SE`G\v.WPwO=Ŵ2#)+6[ ֽ*Gl04R ՟ǩzK($ےT, ߙMm,BT#m4|=Aŷ=jN.DcVweAR[(]o86e8i%% H $$rD6 V pE5cп@"kKyWqk[6bM8 3!o ¡v|o+X:EkJM_NcNtMӃx~HpyNbE*D څH?[[ ]TP+&][B4RmҲ5=:c)S\iXsGF I ["}_Ƀf,"*6'v{8b3\!iv -~9yRJPӸq܆y`k[O3UZ0#_a-ϑz0]2DEfmbLV'~MV6APN`v?Iǒ5 `jw!~CO2$N=Ov~8,k5o#5:sOKش+#2Ķz9Xevsiȏ} D1 Ƕbkx7(4Ir_@ĦF85I&@!xjƘ>:*O$cҤ펊ThZqNd`S1BP>TK*ꋹ'_ ĐQ dJq '>E?iy:d P3H׊ ޸miw SbiՅU{|JWbwf1oRM+0ZF˶߯nU'7?3[jF]HlП PJQθ^hՑR:f||[NdIP 8և:J#r>0N_6 @jT扛< cO/V3ʃsOF1uz.uq25^&9Ԏ2ˠcI+Mq[\lh\=&%2R)s2a']"n<[TU ĈvcusŅJl S׭wĪ}vJ hآXtrUlZ$҇HVE>'cvCFI2Fi7]$n;*GOBgUX7P M~R< CN~8Қ$gH^+Ƀ]@;JƘ$.9$M>¿-Hh$p@EvӉ"g3ưnTR#:V q%[/ЁZDmWN)H~0܌ekP~&-c%aiDQdN1RrmvwW $*ЎrK%:}q(H@?YμuԎU_T#: >{N.L&mcM~Hszǯ_B?6ܸB{(yæ 'Uv8Ɗ܎)`  Tʮ7f;f1p$d|q[BIP܃m%)k`E>X1ʼ%C@[p~[f'i\鄜Fp&ڝLIX^n5pV\~GU NXX̊ ExOls+2 hIrp>\tC#րF)CJKI⧠?29:9ȥvp7f?)O&jS$['%%mս-{;rUEzpjfa2zrIv?KWKjk~#x_ VTMt )G# -tf+) ç33*҃R\/3FaܒZFhd5)!GP6Ġkdl7~r"TV>i>L_:'G9y꥖BZ! "[ :X Q`aOW1rϋ(#MІ]`kӇ<4@@BӏG.C[rBvF\E [Pܶר-:xM(o 'V]H]bƒژ2۸Y>2 /ai09Q'`UM>;+=yD R r጖'}4$fj}W߷Nc=ċWn$rwoo2>dQ̴Ԗ+vpZV?^꽫՗J>"H4<}3";۹2۠'k}5y.C1޿cTS+]"+6%$4ۖinepcmLJs4yjsKzuk5z.""^lEdr'\ƠŽ&%E>b9v5](AP6+$qU#Jc$ J4o{d vZ|w!Wr~:AȁP}]ےAtVYce?ˑhA b@^gv޴Ƹ[4-̒(f*L64NH6<$AbOk#DmO24dzoVK>J)Ţ1*rIW5"Ww4P+zS*M߀&tP;av.Fkz9'@58!|DM75hU(h+֘…7Aޙ VZuԌcX(Q?jBT,D>fUf>g2 J0JjnXh,nLŨX }cȉ FC9`J3T[ƍq+Z*VV )Bkדz0ƕaTAU;VL AQtF$uĮ1朄B\8l|ЋKrA+u?%bHn% Mzz 6"8Uݍ" e25E}Ŕ ,C> 05۶ּ-@ CG6Y 'm%{8";o. liR%b滑_ Dny M_"̃1C>t-Bs=9ԝlx2:57GM?dT8:kv; @;PgvPkZ˦y}L̬*ICQJ;`խEIsăe'&ڵؒ|*r'uow.M W]-rGܺG[%qQͅ9vyg(Flt)@OO\psHHO.D HZ_ *]b3h Dk{g q /rvi;-\K;-XM| RWQ-ʊ`kdACo%NSs5J'IuR8zui3ɡK ;Zʮ)x:6 A2vN:U{yr\6w@D7q4wSrgӜRzE?YPdǏccyLLDn%kM~2R/1,aiARTK|~0?rhS YhՐҀ.\岛Q#EG1?74[g, C銣R s+H"*rqiBH$J,5qrܤmI*1U**X@"n= ܈QT @i ˰ #P?mDc`>4qR{rf-:WĵA|LTR@ sE|D6t'ej9eMǵ^]'P6f.9GT֜{l:' xԑ!F;%VAk$YR:_OX}4lɘ)_,Ũ^LE[˟qR,bw+qaߗ/Q^6Tۖd("(S-Ӽ_JZOe^А:LEIfpxN-MTvкvN\Bb{Rߵ~y4/Pp6_s49زJ~7rX3V:lMO.YۓH+ILx,jm Ϣ1SN,oǦ(Az/Z[RI 62)v8&zur3| lZތdPw;fF9U7aJǛ-Ch> KX->6kE*FHe%>*vn掊F9O|M8$m0хxOh:Nj1_PJ7d|!{|ypj9Hǀޣzw8ВiᓴPPv~ŷa]Xϒ+F#mĕ]ITՑ䧽y*WՓb6'2+> '(iA3y&X`0,€5'N#!XJDH'}\08]>ԦYyʽkY4awxh1>0?.BZ dz?-a6q%eT|Qa7(XQe:iRl'Yג(Umcw,Ι5rb:s0HIXfZmm]~QPRE7%NYL!O8P};DZ@ؔD8wMlwhtqJx-rG @ڐ \h(=ۨujW~,Neu94ߦ6q+*єҕ۶5rOG\*|_ bw/EAODT Ћ5U/ao.bb'̃ޭ%A+GsO([_)$|81TyC{)8|RD9 wa`z'ٍ˦7qU3К1=V*&٩1Wsr&T6">~&Tq'u;bB݈֘\*S4(' 4k]hRaN5NZ(n¸<@] xeCcH-IOpF(Q7Ĭ ny$fqĪ o^@cOy'K9t+04b? _9dznنlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t>&R?\\/>`p.==ar[N>=鋈iZvqbB$m O\U% @7V)U4AbfE#a>,iDcR8Sf}eGrW6:q 19+NgRfD~J\,AqYG8tqf^#89R|?hCKLXsriҞ8+|pvҞ2 9p=,YRipHbfh-nN;Sr₀>')%pc s]'Xu?VAh"r-ډIJ TS05 a*S$"8ހWr[14=L֖ڔj\7:IG`0~~.2EFh͂5շYZANJwE42I`(@ܰ?; 3YBo-}8JQzEnb>*䚀X7jWI22UP=){6%(zSɖ]iyqp(P~=va,-XAESC{ReTX/c)'X]) )N1yQb3S@*$t}ܝ϶&#aliPmǎ>ؙ$69d \P\vupʁF퀝hT-bj֥~g$\9UQ;jEITBĂhxB3(剆v!*6l li i,@ОbI% WL\:J֘}U2KkN2QCJn2'MK7#nx7o\u̥4 :I 2ՉvڝN%mʴ"mӃӱ\bO>m<Qx؉ ^[͌' Iea~5"X5{).[A4hl2 \]ۀnQRCq%}W4Kf2rNQ\8BxGX|?X{ _!-04q.]j@&~,w:f,Қ\aƝNLF}>г#JxBk%LU؞Uo, {,fcV4ocbH OTRKaT4J@uฯmx 1jmet9 8ZE 2~#\ P U&p@*ïl-ƑV.uJueSU&~;m+M;}_I SVIC-UFlc\bM}anXK@*/ڥ|<0R8Z}b4, Te$cQ-{-E;Vv/'XO n bSz$2P|IF͹qn*Z~Okdߐ;jg͈[$z$ .8Yv\ >y[tͺ]bwlMؐH1ϒGEU;;z.r/=F0@4?2}73{"*~*Iň@~C9;(22o@̕qs]{bCHa]*Hj;uauf$p ׯ\_kɡT~ = *#}2<0LšQWZܥͩXiQk ,8Nw;~?~HHcH| HMn" c8r:+Gu @,śkVŠE6vi2m+/w3MJ=V@Hc\ 3?݇4 m/#u؎%m`F7Pz˧!?=lJb|'zwq B(=r^H'u2J|(&WBD5o~Oީ$l;0;:ZRt o[)bOrG:+([ԧXkW"ubH$g1BËO(y,#lmMm3˾}vuQ@RO45k:yj-}0bXb[]rM\"5j§s_H:Y/$4[{BV"ջ6 AUM.&8kԮ&Y'8l:|DҪ5@Iy FNqġZ?ȋP\GQqxKqEc"Hw7 `+lHĴr:儛Bg kf7ufoaf{m΢?',,iծ**Ws^Hj+q',ssĿKҟ g6;`uLa`j;s7n!Le}MΤwg Zx}`-PmACn @|1QpH:7Z)86S}LdV4#s^pےM?^]ǜ7"6[w5Hy\*lʑvní1#)I16ҽis;"1(겫~xjPHO9\E^˂1NdZˬ)P.`jRD(YU˧ӓ[..ꨥs^D6똀77{#HY(M~ l{n( ?ħIC??U=z3w UKץTm qNbs,wl ˹ޘN1B l`'q 6+g1qbhRv1J*.¤Яȷ<-d6diп-<樣JXYff~yo4=3; ݑ+Wɦ{~*t@jW>DF*6GpuoNa 2ZiX}|g{%DFgg,*j(jH* uX&%"R|jPSƟ2uԐQV?H?.`R$r>hͩqoAP7G`XOsBKvȌXKR܊~`l|qƿi,[%[j|}hTޣv퉄ޞۑs9aO" "b H*Qg(;a<hIU폐sRF#|J 1TȀ'8 iWjWtv*rE*qZǎ - #l'e&$zG.B'03裓+X'xUM-?1bRt.]BVVN7AHCzY&ǫܰ-UKԯ~&s,մ+닸OPVJŅkeA1KTs]?g^o-\*BBz}25&e@; ;('dFYJwPFEw~ ٗMY$QF9y GQ}$(5;}1Ce*Ԋbu1U揿ҳ%# Y;튘L7)L݈X^%(U y+ٜ"dh)9G) C\@ڝ=]4d+ qrdOS);c UjaLB⚠rߵ#gj )BGhw4K1w# ɯZ} &zb,>ԭyҽ|Zn \!UZSW0qm$(5;fp- @A;Q+歠CȧAz0]_ok{bf5/FF]hiޙp*!F\Ns1&!Jl@+өX6usZ}fW,ܚܯ8B?{$[vv1.kZA6fR> lC<,Ec;rRz%JUfT܃?g "M[#lGEs.2{(y>Mn͹$?+8<_GTvec0Gc2գ֒=ZR >&cnx=v%^cֿϖy*hɨC, R!,c;og ;uOO?͛ρq'mn v4a[jՍ?<'(y+5AUZ[dE |?oF*J;r^!@W~+bmC#}sԪ)@M)^N[R? _GT ^s`&OJb!VW5zJo'fe%h osZ[4(;:O&a5&UŚZ飌7#i#u(nH84_+UOsAR@e\5Zc!ekM.ɲ.K"=2u^% _ӗf&sny-5{O'ܬM'GGjC{y2'ZoҲH1EЗѰhݫZe3"Z +$~|MkSBWO(DWuz llڜΐMhVgӌG X/`=>M9 m,A? 7lSp+_[.Ч21nPzZ?d KL1-dy/hXqZ԰[SZ(vʁ6C 4G[T$'G"/U,r-UXU ʫߵ;N.Sz"ׂi_吭gұXѨQR5ΧO2g6%:"=ۓ>8_/1T06_|x#dgT4$|_zĒ1o`$pㄡ]Sc3,A% x@ ]{W>jpF[mmx MROQ±e_ڨŔ&Wq! ;jGZoZdbUU^f1# RFۛ%7 h!RwVV\z]}Xp@<<&SW_ލ ulJ',rvq%{xȠS+2v4d"[veGy7T4GϔySftиd?Dpsaؿ_|&~+_0ȟۖ,wu3 Fq ݸ  t̸E$lͿLhc}0̵$iB!Tb)ۮ&Ȉ\ԏc•P:U@ ׭Oa)UP:)QOAޙYd;Bf뚘䋩b-+(MGW"VB*9>P_d@b^mVf ZE̐q:É!?W#dn^Gu6}b~y<%[ٖ +;B|yzB(3ZrAKՏBil^"]#~٭dxr3h7 /sbYT0ZVRA 21mb^?i!$Ԟ%CD.om6%U Q BoKrCsܖݿcW[QWI mc0)%6 C$iэ K2;x,Ѐ[ ^lPx$@!++H#A$rPNS݄BuqК\MՅ)޿ 7P;7]Ҟ9wsmVE; $^EƊ7a'e? ki #IzCv(>%G2;slٍ8xDJd 5'NFȥ2U_ziUӦ)D Ch()[ZUY}}X*v')U'L:u?䏧 wS%\o,iA߰t~/tȖDV\D仕 QیeNr0?y tIff{|2N_aQc~jm4#qI갯Z*~ukK ,.RnFxRnT\20!$u`8"@* BGvtRmV#֤W$ ƊA$|0$J$I+7R\(2+©5%ѩd drc6,g݁dA1=CB(:f9t{"E&xA-t"~CrY;]O` :VCՎIO?K%Ӽo;%n2jC[}%!t䇥'ȈJ0L<z5li8 nƽ76-/n[XȎ5;ɌGz҂Lo.ɠ >]GJM\IL`{IXNژ 8+[n7Jǣz=p[VF!o| 370 }'PCQkZ&[masI))"=X͡Q*Y|UNs$842DŽ܊gFЯfqsΞCUŸKyRqR*?pƈjX҂Ú̑3**aƾ04hC<* _,nj[F P?Ë*A*A}@)Y:J90@ j`;iApT4<ʋnEA,۬tڟvE9mߔUsvHpPSW()&H9㻈K9!EDu}2K{;2W| Mq 7Ubx4n\ جO};F7*l<0&'ܞbN(i1?VZԖNU qUЂ+]~m;⪊z2u銶P$?G|Z9 Ì|I*ȴ%vqUj̵c%@,|A}?? /=ؾ9:q{'HͻfyWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]v*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t>#wG˓}"zc!6Vjaq⩄O(;`¨a]HkIB7N,QSEsSV7!aS]Z64URG7Sj1FWA!PkZS60U9-@m*]iU&:9 0*ŨflW,U#1ըAoX$PwS*Otǩ52cX< +Rjc Jb| {w"5b[)xJ`(7VU# 2)M}d2 ڠuVHb_ ygHE2Cנl8$wYAz %i^T]C]_BV"FL܁JpwǎL2ZS%D$(1ZFrsb5쓂d+U`*P?@ KLriц0ֱ?04Zt,9:lvmmTVㅎ]vɗUR+ACnV?1J2hSMxҧiHf`(tlq(QtS%X1'uۯZǁrSO!ҽ\с#1U nim]֛_ˊVd@qsbܝQ*7LsBzaW a}L[]7˒& j7YkjlG|tQPN*瓎T{b!r?hw EgiAVJqvƖ o PsEOZ|;t,d0h:RsRT@+MAt@N0t/^+8 E)G\$ -hp)Hjh NA *Y̓Goo dq@@((qh-[qӾ>HLkZo,mlR =uXfTz9颲J~c8@d rTj@ƥU$T첢{ݴEB~=@ZNwxcI <-)Hm[" B#>!z:{<AR;ɡ풉ERW -lLy3+T;ӑ+# w*s=PJ11*8^PxKcŜtJp9($qR(7 7nPuSJP IoDVQR}VU{Gjq+a%ŷ5VT#}*BXI^ x0zo@(8cBdJ0%w璐8#NNeĕ+O`0F4?GL&Md' 8TW*;2rUwlm %)#|R[SE'߆2DTN@_ Vg/ u?«cPe =>~QdJQBⱁ' ]% ,7'D3.>KJ/׮)7CE-+. U* o-aW,QڔȋH7i ׃F4JՉ bC^/^wPh^61[i]TJ{d8v#.|Y@~ma<<#h6N%@$lOOl|F֊>zv֖6I >?< wc _~X 2iƻ, Jze\GenJ7I\tq'+ݱ̖z5V4M%hZD ԨiBY8q;d=IwhXFq& YNoFv@]}Jf0NnZj? rp\_ʲ0ͨKUb#QU%ŸˉWWeO@?huwd/#K=2 5f֠~.<,}R@v#|g-)JJl>ÈUr$=iLH??gEGiKPJ+@c%Fg6XQ҇6 ):r@ v #LJȬQC]46NfW,RN|~;[*ǩ߉Jj"=1YXEBs=E pՏ.$4V$ &ʪHsAn-]ؚWu"wJJ|Ua~#-.y5:mbd#N?U|5Ϥt T<* 9!njEJWtxGQHvĿwV*۞V@q5$^5*gU+ I'[EzwE6z&+5\#y-oN6_{s<,ە:%7ΏG=h:df0yz CpPz,"jW ,5iEuS İ:~kiH䏺$"iMϩO1[$d _cmuu?+# _[IbB4ntX xR)LlS*j686m2PUblAn_)2,$5G6?. u8di*Ě7+g *ɐ -6O}^$~d>.?ٚ|2'} ڕ-)@խwb~]< > )!Psé"`Ԓ@_$eL+&;+#Z퓋wrP޲yy? VETFjkJ\fԁ^aB "rXi܍Q|u=(D.KE5 ݱ//jnܔ;Sސ^vO^dp'9SI#\ _׾' $UMM+CSP-ER8F*%;cJqU㟀{bTF b;D6}s)QiI'nـn:i~p zmCMlc7c:VzoS{pNkȿ?Οef_t_8~SBy?G8m;/͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tٲ:Hrsrz =`F{J7VzMTb%;m;UQoP),x可^l;qZnL}6G51UH? aU H 2ׯW)Zp>3(zvlUѳ@I$5]*NOϯUyn|qU @95V̨ v|Z9T֘CAyFv8N[NI U"-\U/&?ա?W*oݿxx{[zHUboP-ZLhP *''@ҿ,9-һbWoV2j滌yʭͯW~ R zD]+RFflfcAB;=9(2$Z\Fi5b~ S$D1ʍo.hgԬ}./RR2@:ڞPjja}ٻ@ϻ(^&%"K$ӡY-퓶`uu5ncM!e V1mMz= i\P{A)WzbA*RIڽMP)YTxJxm !LJFm3<}P қJ DZJuc0J$t+Ae5F` zj=+%Q2AjH)7Zt!qުkȝ!MTڔơ.=6,Wq_-.a'%B@PFhW»diV$~x"T Fp|d!r@Qx 5XHC86pzPdp}e(3m$X Z4P)r* HE+,w&ڸo@98 XbVoU퀡Q&F*8-n핉g48 z2 ~)@iЛ}S?K"2v2My,ϪsRZ!VKɈI= #sHp酷w**$R-r>呡h啽7.^F25!A\aiHQ)RVTmPi]%L`qL)[sd:@+ dR8: 9 s#gqU〞-.:Z 4)V Tj/'UW Jۑ)6o99!Ņ@5/.X*&BU$#ȝ2!`|-v8.Lqڱ@jUXbP4WPY[In<[/r|B␧h h#B׍~?,ĥ-pW<@$T7z<4Tmb>?g15˭VQ,TnDwoa:2촸c1\ZWz }> I(AQ?ώ[m(EUw$ӧJX檻7$| Xċ mz O7^P=);P޴O |4<l^Zqض-nTh7PܻHR˽ݬb:#ZYeCѰSj䎰0jH`{(+M[<6bi^@*EG00z}'sM+yh)JָbvmMVl4X#P`%BGmE꧵ Ij?Nb[욟\u$Y GġXv2 `O6w>'uhfRƴCOpI mn+ @[]qol~S]2ku Ԓ*1RmQJXW7Y)$M2yGs_؎d8hwFIB;2k:Z_O~izvtrW^/Mc$ג #/a_P4)Cdш%8cDfc't;IϬhBj~1 Ln }'ռ&8\e>ЯQFk%äRN1i^z[ ZlHmu77~((Co|qõy;K" Hߪj4B(_qZf6[wa'*+2~\r G[_ĨcT1O_ȏ[*0ߑ%n|[7'dgry%[V is[ǑٹP;rue"@mO%HkMn,!U (WӁnHJN` FTkw cڤSxX7BIWo|1E.ROjC$ʡ˶F|ݲE* x~[֩ҝHs?jdƽI8&9Q;2B~1}9!ў^$*wT]R\ >6(~*L&!BƕMMzߺ1ݽUvS =zFCb@C.CS"w\Ѧ$!,hkҝ|]6U#%R&ر[CZo ^ݹԯ. mWvҤ$|ŷgCE7̘J6|4,%|?Sy2%(¡.lBeYcUhjGkQdI[0N $bF;d i]"|fzei~(kQ]dMqMR{JۋXA(-WS:DZ$q;j6IA#(*~K5"TH /y-XZG؃MͿkp#*փytLg['h9*0\T@<=Xږ b ԯc8)%|ܱ;tBF&I+HF*̼26DS'uG׽9gq"Con2 3s}rV+\uߕ)ALZ)Nyy$S@9Ŭ?v'`^_:Ķq!T~/f;dڊal(tkV%*)^@<:$'W\3$xk]|_SYWDmW\g{4[W`$iW`}~kVUQJ҄9`1˴U.G"ՁoV3&`-&+ٷ+L2LyjHFT:eGdꥍ4>RsQMRv5KuA2j 3z`%}88p5wbzS4bHI#WK)\*nztN\QTޟbvtSf xb8( QAB?N y<9OF:9|Q"9$bf#ݶ=Zj}6 6§|*9o $CESCMK%TRO^g"E8 TuYIC}"y|G0%qŽ.}TN/D[= ~p1m9g]^AMKJMI{f4hkiߜ24*J-hN4E*ǘz6h57UHdw%EO_dqQ!@Ȓ@@ N_b3)bebU9Y2$9R$Q [xvXV9#uױ8B$(̒U(P@F6'd([푰!5zH%gTvP\yV Mjz3Sn}xT)|d#F Nʪz%i7pN~ӀNXC0ٖ7H3#,`ڿx7eai&I*jhz`,`1ĤW@B)L1x}=M]FՖ}sM>(솹X 0=^G Hy~R8ygW3)ҽbnb0<Kٿdd -SCױQ(x#(0+a*S0j cFR%_fٻT6TY!Cbn8 [:bF5_c5)Vw4;kE"5z>8sOO?cMqU) T;cUqT:#~:W看Q4+0tb_-Bٶt6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t6#?ԏ'?/K|DZp6#3tRUE >LQA30LUV6~ @E d% ƿ]Z^XbXkMb8cʔa~myl~UQT%}K\h'U,OzZѺ\yD*k(_<*~һ+SqU?UO|~XFӑc*en\y 8(iLF↝Շ:lzqZ߾)QY|uq 1B&Ÿl5J!~-_?aʾ=Y;vG|DtVО,)*j}FʮmiD*H \NJJ-J/-;`ada3*ǩd#" ;b۝;cc~5"̾aE|M {uTeFI 0Y6sMۆ'R|NشRҫ,bVL4#,f:J»m$7  İ)5!n~qn# øOvB(D%1 F X~B[UjXr,L z.=v $7 |!m{;u>U?Ug=-6bmT#6%dCqh44:m+J޻IM+-)_pZ;<gkJ:xfX%>>8@jce` {fTޥ4%w:m5a^K7U%{j:zq[d@e[ʘEl=H#-.1ij5~d ,Ed%zl\jU3Ph p8#}yM=(Sy=N"3Sf4ݏKdDGj."K%u G钦鏎l(؀]Fߗ8xAirVF^z)?m<-QF~a(?dI<*IUYXpNFŀz2T)n/ebϪdN&܇V&n\n`lAʉ\T9CxSȬj}(^^3+(R잸MIģ+jG>"~}aV0of6Y@~VPPh2pJ.*ґçcmUݽ{bH'5D_U.ҷ GNZӖrVS:6VmCOVWD;uڹI 0 9=oXq =)LVAiԤ8KvTUP|=*N` ;PA򵙐krva ;t&hihV8d6|3ԃ+݌kB΢U{ ,E4:b 9;&0)T5LBiYHkM+һ}ʥ͔JhIQJ~SeVC-b'Bw;t`.v dmX}2/'ҕz\%bi$1A D PȬ)EG /JHMj, {ҙq-9#w 1W[&C VϡC`WXkĜ7ޓwP*?.HEYy2B&#I6ՕmH5{ :<60!MLan?qJYֽRR@OJ8hS+TW2G6=*5cRNvQ IQk TwL0{53TIv>G,6K4P?|݈ †Ay鉻 xy|@[^aV@`qSz/p71ȑR-7>ݐ-;A-Zq;qvZRkS؏|%!uAhH:R +[ K0L}4.RF+hqo^9 }9(8G7>t.OcReF?LlnCy)]Bf% j uJTįʼn*1u(6hļ=E$q? U[om$Coz5Ҕ9J;1mjw>fE/F]/p^2'EYFKV*`;a1[[UJ iZr 864AXI#DĈ(ߋ8ؕŠ敡bij[N<"Us"k4~1ZrQ_k.# ӬRhGw _j6KM Z-u.fd/01%0 5,9.HDLT$P;@H?g9#rԑܚ1$}No#8+ ¿P P:|8Z2I,?Qc0D#*⠆XJz;~ B~t^[Pv;d!|%=4A0Q#p42I2J( %d p=OLx Tvߧ/ o ʀSڝ>1|Az_Ei>jG&'`; r["[54ҹY) ʤ*{*h@5Ӗ?JzphXnJB gulӊPOz_L%rsStlA슖aW3~-锓F`'*^#~qCA^ h44kKє<ۺv9U[6 CTmJGLӞBM#ö 2W4~dPT 5z}$6pJD(ĵ:m_TMIZ,v!~;ǒδQJ]Sl8)n{Ӿ4`: )cܲR?hW +Pݘ}Ř|mt4dH0FB:IT+vNYXS^l߯[0e}P lbmuovPQBv52IO8<-(3Z>fnOK|9G?!Vvj sZ8ܷ-RZГ/u!.  _{ 6S Zn8[A@?FYmN6MZKZ 2k\1AG{4,M ?TCrPN5uͅP3Cf{2 |4d+  zVpq2}9A` *? uG0WeZ6hVdeD{17 _&vaQ|EoYY0JI"ǻ_اx.$jjOzaQE(p  >6|qH#-~Gv\W&6-7Jmdz`2cLbs3=&^dm5B'?g!onvt3zXL^*8ퟁ85өƛABINĤZ<02 "ƞw?,m 5ʟgp?d>N?EԀx1Q|Mv5#oQ=I80yܫ߶8H,aҝr|Z[6=4=oNO tCP"Wi,q"%CuNMj&GSYodw"Fmzр`bFv(&`@Pe|6.\_bIt&yhŜ-37_I9(QvgQ=O%[ɺHGF S/6NMi%*U#~? g|lb7A3Nޚ$5۳KQ@גqTV&KkM5f$ B@G]ަv&Y^ZL/Y)K-?ă$#@fjPt;u;&9#zn7W@sQF;dBCjB9X[]S!"cicȦ`FJHtbkKI-XTJH4no]h,h>/3zg8Dd6SY!VRFGddaVw$;r Ukr Mx@ڠ$CҸRR7SImEV9/ոg[(dq)/[C*N;O^W#ŲR.H?!b/vmR{e2c*Ncҭj96z.R?fQ{NWPsH7?Pt U+ZW(Ge@IwooXg"qEYn(w%j#{pi/.߆W'G洯] CB|T\}䌭ś;aeޥ{,~0 yo ) j}?K*w9pšUE6F]$ڥ38mZ%7 OMzf*4 .oQnu͈t{yh)OM/GAsb960~]"sk=3R;ėr83I㿆+JT>'z|lUmVs2\U }UO w Jm?]vCRIUR6،R~J{I;b)SxP% ~"\*m6㘨T,VSoCYɿ $On2MOv/NN~|^Qmm(Z<#{6]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlU*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t5X4#h^.y5;ns8Cᗴ1 w('WTƚu5X+uqXlvzb{feoPACCLUU=+M_zb,?z#lU2;j:FmcZ,&sjM{b#ú ău­|QeG^D8A]A(AC UTUOߋ,>xk-kRp˾IZ:C\+;5Gvߨ_ ZӮԪ≾C|FӦF uimnf?ez[!!mȌVETrQMPH}WSؑ0kl??;땵umI)7쩧6D t#ˢE[VDu27`d-}E~AY3a 1vmbQg=ހ,-i_ V+R{Z[aspI|Ŕ3bL(sF~HlxT`tuB||r| C!!nXzK#Rc%k]N7z`;9H,@50Il*li>R|2*^ȍaf{ B_uD@Hݍ* &Ba4ڳ˥O-h)jdr3R:޹nI%)XbAġli"! l@$QG@n P5:RԨ8Z6~y&$ *87kvq҇2Ydzo@2 wpXd*I#ЏՈޑĒwܜx%%s aCIq)3qM|(;bɦ*%-VMȧl9 8ݔ=8¾Vu-CORk*'Vv#鑮K\UB*;Ns,2JYRܞFjm"zd" lMHȷ@v90Q&NG27fHꘆvm84?ƤZXdNjP(z|BǏՑ gB35p>%4"J}Na* $]7Ѣܣ~5]Z2/0i%F'co]:e4駔_NRbz,_f)rVhA •kBGD*EU(|k+_O읫޸TdW*DX`AP)ըܲKJj WMb6Alӕ߮)#DNP@ڠcܤȠ+zdU OSwcYBN46!Yb}^˒hnT9ҿCdm!(tS[IRNjP7AyIi F4bb6+zt]V. zWK6=H4jF!>Jm9 ɋֹ1Ӽ>/tFOvkQ?9pp({ պ%'؎95#h +0%~̌_Yg,/K$AsF&&HjSo ,r;12P'dqEۓH|++v,jP~1m.wu( eJP> xk‡VO/hQ]-eAzxhneq,B ~_kpDp%k=H+JV8eKW,JhK@ܫ_#[I8 $uW0}JlDj(}zQYv|Gtt\5m5;7 %nWaAJ8W4UE+^0]!1}UV,I7\UmYBg4uE;t'jdr)m2W"B$ )^؊;m NM){U (&@*_f1VҬ (A;}bJXI^meJ<ִ)L̪)Lhb.2Pķ4rڀڽƋH,3GyT݀wQ~+ XUc_MsNJ=q` w2BܛwT<[\>O_9XceQ9VE坟AjQH&r}gV[T(T^b awk&z4MkN+J}@ĝwOJw=OÍxL$ /c-;I+sdԚQV͋[fE`c!W~Hv&T<2 [*M@g,Q.j8:0)ԳT~X^I 鲙B;WjfQ96gim~h 4, gYT:+IM0B)B*Ѓ);`l0^æDH!YfG&-'ĥE= 9 PUaY "U( >,l %ETR<`g[{jCi3ƥo+"R)sKdq SSF69شQ1Ia#Lծtؑ!#95@o.$R] ll:lS"#hĽvѻn$(2V $7]'/O_l}k+͖}D6BDs4nb Emt/!`t}?lO4DY*5yt#Ll.F[(M0?w|oTl SԵkSҪJRm"!Ѧv´N!Y!ʕcmmdw|M߶$,͗a鏶tiNE0SڝX +-߮ǚ;L br$M62xUcɀ:dS$C v܌B-J&b6a\ESj{H5d W<+E T2&Z0Y b, uFhb"H t/-\KKtcE~8^[Y9u6O-F <rr]2EE2)S1式z 0a%^LTn9Įm9hRoqO 26 R5Bm=9Yyq?|P`VE*4؀0 <-Uh?YU,O_<`D? x|2-'K.eK*[?:#5"^!h}yA.,nkuy:eUHJ6s` 1ubtp.rLQ,ڙQɓs#PLB#F`5h{rc+4q͕JuO,l8jwu8mUgUbNu;5^]P @r@ M*`kIC(ft@H"ҪȋT0Z$RX )C4<,:~8臹jZp d-i~61l\P􄸽k'"K 1&d" 䎠QnŹEZbRR> Z vr<#TaZ7jV Rڤmn3Wr«қfjbCei7L=ae|M2%u &b 'mHAWJaE#b6߾2I-{|$aޕɧLh\2glo_mf%x1J"dnf!BIk3:t؃ ti$½qT }{b4Puљ_Ƕ*`z* j|,;e5t Ws4Ə)W=@$wS2]Pu;nRW5O ;vp+APhaO ᜏi9V`鿿Isߗ?*Ďq:v_vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?tcn~?qܹ9Z_{IVߡ${FRiK!$Nt̢E8⭪RIbēpZ_ljlzUdΌ2=_zvT$J=DJMGzX }b]e5lNAKkN,W'6J5(9u5FAлM㔠JZ\GO}LLmR7|Rvʅ(!-iRv;+U$SnmZmYA"č:}8UlhV!NkbP<)599}bA|IOrGdZ%wޝ͈b|@%rUKhi.RFk?b[UH+ۮ ~DǷj.'8n*T@-ZhEI?3kVmst\p*mӶ5V??% VySHּj;@L)O\1A4!wxb{% 7Bh8vCdeVĩN}V(N>$È搲8 -L :*{0;o %F?BE {> Tૄca<}3ͨcXƿ (G˞yc ܙxJL^knoU#D>`{kMJƻ 2 |VpFSAZ"$Ky,DfV^ԏ2D"֫\ڭ$5xv4#nƔrځP9kd( |FչȤqO -.Lj;SL! BG{`tlEK0VZ1=gi54#}&i=?Wإ bPi嗵V6^6z[\.!"vw`8_glY_I*z7v_scϽJ5(ԥyB(B#ӏ[Jw'b>>?#s=zy4)Iz|>]JpT/Z.3wxU(J$$`c{SJ{ZO"d/o!µT!>ƀ%+b\ EK =IuU@Vj8FHI#m=yu$d-"|*i)uF> qic&ZZ{qQC /@= iMa־%k;|7Ӭe~$ 1)^QڕZI%LAMlFPܻZR~%Z6۞İ@*ԆZm]n]3,⨡TE<E\hTnjqOhA `;pss:**+(H'o"K vP̨tH_%LqqP;Tp4i&@َW£+r@5cXE~"XdNQ|<^Hq?̀R#=-B}0~H RpbuH);8$r*fH(~>N݌, S8X΢7iiNb hI?) P1e&p%j٩"hBGq~1.}%YZ7HUv0N8JtZ:,~7mMJBg@]CnP fSEb]x`GzhFW'"TvGߛO=1cvضH@6 { Yu4aíHT걪ե6#~R0.V \[*>&Tʶ@;Py?sϞY2v"(rBWoN#pv] Wګ}Dd?ۡ|s^T)>j^}QEV^FT|# a4-ibM4 T}k`h`eW(^U^LqĊȚEj۳8ׁn@9q+˧<vȞ hAFL eړ~D^ݻ\3 pNdU _4sJ]@Lߐ t?rJ0Zt .O(F,rǡs1iM%E?6]jFhڽIΗ8]oH7;mQA ٮbaq1ռe50" ld,;v bj}Y ^K<(# > N#͐*n@x;Б)δ;yؔ5ՋW4M{kqvjfxKy|i_J'U}(Qzb0BdA n%,KpE*DaOLYFBN5W4 oNl ?K3m}QzF]Yb^J*p.4%!{llk \C}BD-ە?9&e!/׸ؐ1[>򯛭x*GNT';'.M3)BʩNev'=cQ-,6nᶔ@]LYX0*G8xƏJwخj<6xc?s@Aܛzs@dTQX$MԢy&IJzGv4ÈJOFLE>0][ @w$"% YkhRoA"$aljT䴡;rIuY-) VI) ʪ>_ }*9R(h}˄~0ӯ&-FkB)rWͦ9z>Q0vpGvR[ =."`X~Ҏ3BI$yjGq1'8T'CN-488OmiPmۢRZtVPgզ8F$J/u(aH )3+vڤl2`wk!4/@uMNצ)$j#)kPOoTjyMgT~!K!3ChO];Q#k'mæכ;lj&zx y\9I{7ks i*RYYkD?WֽXؼ+mBߐ$:|._`;|*BrrE2= 4",(GwT5xyl2$~L#>p^FFZTSff7o՜fЙd!)Ee zz矡@xDxDŽ,;;C\~^,T$bd>Gi^Myˮ${ =pV)R}dFIYhݽ5ZOF&p.ԩ 8QE`w Ҥؕ%ܺ8T T +F'hXSfm>K'K,H,ݎD ŊR {d.Hʻ C㛫z `UNp~#ܨ%́v+Ż xbk;ixbl PeN] ER+I-$ 69L;->h7u=AȚx,zb$/:v? ^NF$5\Pd^.zn$5t&NSتM@FeCNتBɶn__{}ruv'A^rĎqۺvavlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWf]vlUٱWg*6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ثb͊6*ث_ܰkzg 3E?t#w/ Jf,cP~Pw338 .TޣPBZ:7 튫+7+ilU VϗqVӬZ=**<> sSS\UJ^*T7Sq]Iץ{ШT-lvZZFwq6SQ10Tr V;}8wdo0ga SV6[I S